EMAIL THIS PAGE TO A FRIEND

STARD4

StAR-related lipid transfer (START) domain containing 4

UniProtKB ID: Q96DR4
Gene ID:
Human(134429) Summary: Cholesterol homeostasis is regulated, at least in part, by sterol regulatory element (SRE)-binding proteins (e.g., SREBP1; MIM 184756) and by liver X receptors (e.g., LXRA; MIM 602423). Upon sterol depletion, LXRs are inactive and SREBPs are cleaved, after which they bind promoter SREs and activate genes involved in cholesterol biosynthesis and uptake. Sterol transport is mediated by vesicles or by soluble protein carriers, such as steroidogenic acute regulatory protein (STAR; MIM 600617). STAR is homologous to a family of proteins containing a 200- to 210-amino acid STAR-related lipid transfer (START) domain, including STARD4 (Soccio et al., 2002 [PubMed 12011452]
Mouse(170459) StAR-related lipid transfer (START) domain containing 4
Rat(291699) StAR-related lipid transfer (START) domain containing 4
chicken(769322) StAR-related lipid transfer (START) domain containing 4
domestic cat(101086371) StAR-related lipid transfer (START) domain containing 4
dog(479141) StAR-related lipid transfer (START) domain containing 4
naked mole-rat(101700970) StAR-related lipid transfer (START) domain containing 4
domestic guinea pig(100724156) StAR-related lipid transfer (START) domain containing 4
cow(100847750) StAR-related lipid transfer (START) domain containing 4
sheep(101108571) StAR-related lipid transfer (START) domain containing 4
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133774 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133774 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133774 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139164 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139164 Rosetta Predictions human pricing
NM_001106159 Rosetta Predictions rat pricing
NM_133774 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364184 predicted 391
2 SASI_Hs01_00033912 predicted 263
3 SASI_Hs02_00364185 predicted 389
4 SASI_Hs01_00033913 predicted 648
5 SASI_Hs01_00033914 predicted 438
6 SASI_Hs01_00033915 predicted 583
7 SASI_Hs01_00033916 predicted 296
8 SASI_Hs01_00033917 predicted 321
9 SASI_Hs01_00033918 predicted 558
10 SASI_Hs01_00033919 predicted 236
11 SASI_Hs01_00033920 predicted 306
12 SASI_Hs01_00033921 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216208 predicted 986
2 SASI_Rn02_00216209 predicted 556
3 SASI_Rn02_00216210 predicted 212
4 SASI_Rn02_00216211 predicted 443
5 SASI_Rn02_00216212 predicted 338
6 SASI_Rn02_00216213 predicted 1127
7 SASI_Rn02_00216214 predicted 944
8 SASI_Rn02_00216215 predicted 299
9 SASI_Rn02_00216216 predicted 796
10 SASI_Rn02_00216217 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024952 predicted 780
2 SASI_Mm02_00338787 predicted 547
3 SASI_Mm01_00024953 predicted 332
4 SASI_Mm01_00024954 predicted 806
5 SASI_Mm01_00024955 predicted 247
6 SASI_Mm01_00024956 predicted 263
7 SASI_Mm01_00024957 predicted 317
8 SASI_Mm01_00024958 predicted 461
9 SASI_Mm01_00024959 predicted 209
10 SASI_Mm01_00024960 predicted 774
11 SASI_Mm01_00024961 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133774
VALIDATED
STARD4 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133774.4-367s21c1
Sequence:CCGGTATGGATGACGTGGTCAATAACTCGAGTTATTGACCACGTCATCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133774.4-691s21c1
Sequence:CCGGGAGTCTTCTTACAGGCTATATCTCGAGATATAGCCTGTAAGAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133774.4-1076s21c1
Sequence:CCGGGTCTATTCACATGGGTCAAATCTCGAGATTTGACCCATGTGAATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133774.4-205s21c1
Sequence:CCGGGTCTGATGTTGCCTCTATTTCCTCGAGGAAATAGAGGCAACATCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133774.4-422s21c1
Sequence:CCGGTTGGACTGGGACCGGTTAATGCTCGAGCATTAACCGGTCCCAGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133774.2-979s1c1
Sequence:CCGGGCTATGTAAATAGGGCATTTACTCGAGTAAATGCCCTATTTACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133774.2-216s1c1
Sequence:CCGGGCCTCTATTTCAACTAAACTTCTCGAGAAGTTTAGTTGAAATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133774.2-435s1c1
Sequence:CCGGCGGTTAATGACCTCCCTGGATCTCGAGATCCAGGGAGGTCATTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133774.2-692s1c1
Sequence:CCGGGAGTCTTCTTACAGGCTATATCTCGAGATATAGCCTGTAAGAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133774.2-530s1c1
Sequence:CCGGCCCGAGAGAGTTTGTTGATTTCTCGAGAAATCAACAAACTCTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133774
VALIDATED
STARD4 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133774.4-367s21c1
Sequence:CCGGTATGGATGACGTGGTCAATAACTCGAGTTATTGACCACGTCATCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133774.4-691s21c1
Sequence:CCGGGAGTCTTCTTACAGGCTATATCTCGAGATATAGCCTGTAAGAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133774.4-1076s21c1
Sequence:CCGGGTCTATTCACATGGGTCAAATCTCGAGATTTGACCCATGTGAATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133774.4-205s21c1
Sequence:CCGGGTCTGATGTTGCCTCTATTTCCTCGAGGAAATAGAGGCAACATCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133774.4-422s21c1
Sequence:CCGGTTGGACTGGGACCGGTTAATGCTCGAGCATTAACCGGTCCCAGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133774.2-979s1c1
Sequence:CCGGGCTATGTAAATAGGGCATTTACTCGAGTAAATGCCCTATTTACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133774.2-216s1c1
Sequence:CCGGGCCTCTATTTCAACTAAACTTCTCGAGAAGTTTAGTTGAAATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133774.2-435s1c1
Sequence:CCGGCGGTTAATGACCTCCCTGGATCTCGAGATCCAGGGAGGTCATTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133774.2-692s1c1
Sequence:CCGGGAGTCTTCTTACAGGCTATATCTCGAGATATAGCCTGTAAGAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133774.2-530s1c1
Sequence:CCGGCCCGAGAGAGTTTGTTGATTTCTCGAGAAATCAACAAACTCTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133774
VALIDATED
STARD4 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133774.4-367s21c1
Sequence:CCGGTATGGATGACGTGGTCAATAACTCGAGTTATTGACCACGTCATCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133774.4-691s21c1
Sequence:CCGGGAGTCTTCTTACAGGCTATATCTCGAGATATAGCCTGTAAGAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133774.4-1076s21c1
Sequence:CCGGGTCTATTCACATGGGTCAAATCTCGAGATTTGACCCATGTGAATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133774.4-205s21c1
Sequence:CCGGGTCTGATGTTGCCTCTATTTCCTCGAGGAAATAGAGGCAACATCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133774.4-422s21c1
Sequence:CCGGTTGGACTGGGACCGGTTAATGCTCGAGCATTAACCGGTCCCAGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133774.2-979s1c1
Sequence:CCGGGCTATGTAAATAGGGCATTTACTCGAGTAAATGCCCTATTTACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133774.2-216s1c1
Sequence:CCGGGCCTCTATTTCAACTAAACTTCTCGAGAAGTTTAGTTGAAATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133774.2-435s1c1
Sequence:CCGGCGGTTAATGACCTCCCTGGATCTCGAGATCCAGGGAGGTCATTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133774.2-692s1c1
Sequence:CCGGGAGTCTTCTTACAGGCTATATCTCGAGATATAGCCTGTAAGAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133774.2-530s1c1
Sequence:CCGGCCCGAGAGAGTTTGTTGATTTCTCGAGAAATCAACAAACTCTCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139164
VALIDATED
STARD4 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139164.1-264s21c1
Sequence:CCGGTGACCTTGTCTATAGTATAATCTCGAGATTATACTATAGACAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139164.1-513s21c1
Sequence:CCGGAGAATTTGTTCGAGGATATAACTCGAGTTATATCCTCGAACAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139164.1-442s21c1
Sequence:CCGGTCCTATACTGTGGGCTATAAACTCGAGTTTATAGCCCACAGTATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139164.1-1508s21c1
Sequence:CCGGGAAATCCATTTCCGTGTTTAACTCGAGTTAAACACGGAAATGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139164.1-242s21c1
Sequence:CCGGACAAAGCCCAAGGTGTTATAGCTCGAGCTATAACACCTTGGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147176    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139164.1-1507s1c1
Sequence:CCGGCGAAATCCATTTCCGTGTTTACTCGAGTAAACACGGAAATGGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139164.1-511s1c1
Sequence:CCGGCCAGAATTTGTTCGAGGATATCTCGAGATATCCTCGAACAAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139164.1-1519s1c1
Sequence:CCGGCCGTGTTTAATGTTAGTTGTTCTCGAGAACAACTAACATTAAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139164
VALIDATED
STARD4 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139164.1-264s21c1
Sequence:CCGGTGACCTTGTCTATAGTATAATCTCGAGATTATACTATAGACAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139164.1-513s21c1
Sequence:CCGGAGAATTTGTTCGAGGATATAACTCGAGTTATATCCTCGAACAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139164.1-442s21c1
Sequence:CCGGTCCTATACTGTGGGCTATAAACTCGAGTTTATAGCCCACAGTATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139164.1-1508s21c1
Sequence:CCGGGAAATCCATTTCCGTGTTTAACTCGAGTTAAACACGGAAATGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139164.1-242s21c1
Sequence:CCGGACAAAGCCCAAGGTGTTATAGCTCGAGCTATAACACCTTGGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147176    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139164.1-1507s1c1
Sequence:CCGGCGAAATCCATTTCCGTGTTTACTCGAGTAAACACGGAAATGGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139164.1-511s1c1
Sequence:CCGGCCAGAATTTGTTCGAGGATATCTCGAGATATCCTCGAACAAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139164.1-1519s1c1
Sequence:CCGGCCGTGTTTAATGTTAGTTGTTCTCGAGAACAACTAACATTAAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139164
VALIDATED
STARD4 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139164.1-264s21c1
Sequence:CCGGTGACCTTGTCTATAGTATAATCTCGAGATTATACTATAGACAAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139164.1-513s21c1
Sequence:CCGGAGAATTTGTTCGAGGATATAACTCGAGTTATATCCTCGAACAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139164.1-442s21c1
Sequence:CCGGTCCTATACTGTGGGCTATAAACTCGAGTTTATAGCCCACAGTATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139164.1-1508s21c1
Sequence:CCGGGAAATCCATTTCCGTGTTTAACTCGAGTTAAACACGGAAATGGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_139164.1-242s21c1
Sequence:CCGGACAAAGCCCAAGGTGTTATAGCTCGAGCTATAACACCTTGGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147176    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139164.1-1507s1c1
Sequence:CCGGCGAAATCCATTTCCGTGTTTACTCGAGTAAACACGGAAATGGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139164.1-511s1c1
Sequence:CCGGCCAGAATTTGTTCGAGGATATCTCGAGATATCCTCGAACAAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139164.1-1519s1c1
Sequence:CCGGCCGTGTTTAATGTTAGTTGTTCTCGAGAACAACTAACATTAAACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks