EMAIL THIS PAGE TO A FRIEND

STARD5

StAR-related lipid transfer (START) domain containing 5

UniProtKB ID: Q9NSY2, P59094
Gene ID:
Human(80765) Summary: Cholesterol homeostasis is regulated, at least in part, by sterol regulatory element (SRE)-binding proteins (e.g., SREBP1; MIM 184756) and by liver X receptors (e.g., LXRA; MIM 602423). Upon sterol depletion, LXRs are inactive and SREBPs are cleaved, after which they bind promoter SREs and activate genes involved in cholesterol biosynthesis and uptake. Sterol transport is mediated by vesicles or by soluble protein carriers, such as steroidogenic acute regulatory protein (STAR; MIM 600617). STAR is homologous to a family of proteins containing a 200- to 210-amino acid STAR-related lipid transfer (START) domain, including STARD5 (Soccio et al., 2002 [PubMed 12011452]
Mouse(170460) StAR-related lipid transfer (START) domain containing 5
Rat(502348) StAR-related lipid transfer (START) domain containing 5
chicken(770108) StAR-related lipid transfer (START) domain containing 5
dog(100685077) StAR-related lipid transfer (START) domain containing 5
cow(512369) StAR-related lipid transfer (START) domain containing 5
sheep(101117196) StAR-related lipid transfer (START) domain containing 5
domestic guinea pig(100721449) StAR-related lipid transfer (START) domain containing 5
naked mole-rat(101711923) StAR-related lipid transfer (START) domain containing 5
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030574 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181900 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030574 Rosetta Predictions human pricing
NM_181900 Rosetta Predictions human pricing
XM_001068254 Rosetta Predictions rat pricing
XM_577816 Rosetta Predictions rat pricing
NM_023377 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162676 predicted 440
2 SASI_Hs01_00162677 predicted 572
3 SASI_Hs01_00162678 predicted 661
4 SASI_Hs01_00162679 predicted 663
5 SASI_Hs01_00162680 predicted 241
6 SASI_Hs01_00162681 predicted 128
7 SASI_Hs01_00162682 predicted 263
8 SASI_Hs01_00162683 predicted 200
9 SASI_Hs01_00162684 predicted 157
10 SASI_Hs01_00162685 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370475 predicted 358
2 SASI_Hs01_00208953 predicted 705
3 SASI_Hs02_00370476 predicted 816
4 SASI_Hs01_00208954 predicted 913
5 SASI_Hs01_00208955 predicted 1089
6 SASI_Hs02_00370477 predicted 234
7 SASI_Hs02_00370478 predicted 238
8 SASI_Hs02_00370479 predicted 814
9 SASI_Hs02_00370480 predicted 1062
10 SASI_Hs02_00370481 predicted 592
11 SASI_Hs01_00208950 predicted 485
12 SASI_Hs01_00208951 predicted 998
13 SASI_Hs01_00208952 predicted 621
14 SASI_Hs01_00208956 predicted 1055
15 SASI_Hs01_00208957 predicted 716
16 SASI_Hs01_00208958 predicted 1018
17 SASI_Hs01_00208959 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323977 predicted 214
2 SASI_Rn02_00323978 predicted 264
3 SASI_Rn02_00323979 predicted 886
4 SASI_Rn02_00323980 predicted 1221
5 SASI_Rn02_00323981 predicted 593
6 SASI_Rn02_00323982 predicted 921
7 SASI_Rn02_00323983 predicted 822
8 SASI_Rn02_00323984 predicted 516
9 SASI_Rn02_00323985 predicted 457
10 SASI_Rn02_00323986 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407118 predicted 803
2 SASI_Rn02_00407119 predicted 834
3 SASI_Rn02_00407120 predicted 864
4 SASI_Rn02_00407121 predicted 1026
5 SASI_Rn02_00407122 predicted 806
6 SASI_Rn02_00407123 predicted 872
7 SASI_Rn02_00407124 predicted 849
8 SASI_Rn02_00407125 predicted 1032
9 SASI_Rn02_00407126 predicted 954
10 SASI_Rn02_00407127 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118542 predicted 1114
2 SASI_Mm01_00118543 predicted 302
3 SASI_Mm02_00327080 predicted 750
4 SASI_Mm01_00118544 predicted 648
5 SASI_Mm02_00327081 predicted 708
6 SASI_Mm01_00118545 predicted 1006
7 SASI_Mm01_00118546 predicted 731
8 SASI_Mm02_00327082 predicted 941
9 SASI_Mm01_00118547 predicted 204
10 SASI_Mm01_00118548 predicted 936
11 SASI_Mm01_00118549 predicted 692
12 SASI_Mm01_00118550 predicted 1078
13 SASI_Mm01_00118551 predicted 604
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023377
VALIDATED
STARD5 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023377.4-249s1c1
Sequence:CCGGCCGGGAGAAGTGGGATGATAACTCGAGTTATCATCCCACTTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023377.4-1315s1c1
Sequence:CCGGGCCAGTTTGTATCTTTGGGAACTCGAGTTCCCAAAGATACAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023377.4-470s1c1
Sequence:CCGGTGAGAGGATTTAACCATCCATCTCGAGATGGATGGTTAAATCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023377.4-118s1c1
Sequence:CCGGGAAGGCAATGGAGTTTCAATTCTCGAGAATTGAAACTCCATTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023377.4-151s1c1
Sequence:CCGGTCTGAGGAGTTTCCAGGGAATCTCGAGATTCCCTGGAAACTCCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023377.4-118s21c1
Sequence:CCGGGAAGGCAATGGAGTTTCAATTCTCGAGAATTGAAACTCCATTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023377.4-658s21c1
Sequence:CCGGCATCACTGACAGTCGCCTATTCTCGAGAATAGGCGACTGTCAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023377.4-288s21c1
Sequence:CCGGTGTCCAGAGCATCACGGATATCTCGAGATATCCGTGATGCTCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023377.4-996s21c1
Sequence:CCGGTTGTCCCTGTGTGGGTCTTAACTCGAGTTAAGACCCACACAGGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023377.4-470s21c1
Sequence:CCGGTGAGAGGATTTAACCATCCATCTCGAGATGGATGGTTAAATCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023377
VALIDATED
STARD5 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023377.4-249s1c1
Sequence:CCGGCCGGGAGAAGTGGGATGATAACTCGAGTTATCATCCCACTTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023377.4-1315s1c1
Sequence:CCGGGCCAGTTTGTATCTTTGGGAACTCGAGTTCCCAAAGATACAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023377.4-470s1c1
Sequence:CCGGTGAGAGGATTTAACCATCCATCTCGAGATGGATGGTTAAATCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023377.4-118s1c1
Sequence:CCGGGAAGGCAATGGAGTTTCAATTCTCGAGAATTGAAACTCCATTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023377.4-151s1c1
Sequence:CCGGTCTGAGGAGTTTCCAGGGAATCTCGAGATTCCCTGGAAACTCCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023377.4-118s21c1
Sequence:CCGGGAAGGCAATGGAGTTTCAATTCTCGAGAATTGAAACTCCATTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023377.4-658s21c1
Sequence:CCGGCATCACTGACAGTCGCCTATTCTCGAGAATAGGCGACTGTCAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023377.4-288s21c1
Sequence:CCGGTGTCCAGAGCATCACGGATATCTCGAGATATCCGTGATGCTCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023377.4-996s21c1
Sequence:CCGGTTGTCCCTGTGTGGGTCTTAACTCGAGTTAAGACCCACACAGGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023377.4-470s21c1
Sequence:CCGGTGAGAGGATTTAACCATCCATCTCGAGATGGATGGTTAAATCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023377
VALIDATED
STARD5 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023377.4-249s1c1
Sequence:CCGGCCGGGAGAAGTGGGATGATAACTCGAGTTATCATCCCACTTCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023377.4-1315s1c1
Sequence:CCGGGCCAGTTTGTATCTTTGGGAACTCGAGTTCCCAAAGATACAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023377.4-470s1c1
Sequence:CCGGTGAGAGGATTTAACCATCCATCTCGAGATGGATGGTTAAATCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023377.4-118s1c1
Sequence:CCGGGAAGGCAATGGAGTTTCAATTCTCGAGAATTGAAACTCCATTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023377.4-151s1c1
Sequence:CCGGTCTGAGGAGTTTCCAGGGAATCTCGAGATTCCCTGGAAACTCCTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023377.4-118s21c1
Sequence:CCGGGAAGGCAATGGAGTTTCAATTCTCGAGAATTGAAACTCCATTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023377.4-658s21c1
Sequence:CCGGCATCACTGACAGTCGCCTATTCTCGAGAATAGGCGACTGTCAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023377.4-288s21c1
Sequence:CCGGTGTCCAGAGCATCACGGATATCTCGAGATATCCGTGATGCTCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023377.4-996s21c1
Sequence:CCGGTTGTCCCTGTGTGGGTCTTAACTCGAGTTAAGACCCACACAGGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023377.4-470s21c1
Sequence:CCGGTGAGAGGATTTAACCATCCATCTCGAGATGGATGGTTAAATCCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030574
VALIDATED
STARD5 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030574.2-678s1c1
Sequence:CCGGGCTATCGTTACTTCTTGGCAACTCGAGTTGCCAAGAAGTAACGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030574.2-879s1c1
Sequence:CCGGGAGCCATTCATGTGTTCCAAACTCGAGTTTGGAACACATGAATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030574.2-656s1c1
Sequence:CCGGGTGAAGCAATTCCATGAGTAACTCGAGTTACTCATGGAATTGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030574.2-192s1c1
Sequence:CCGGGAGAAGGCATTGTATATGGGACTCGAGTCCCATATACAATGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030574.2-361s1c1
Sequence:CCGGGCTCATTTCTCCCAGAGATTTCTCGAGAAATCTCTGGGAGAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030574.2-189s1c1
Sequence:CCGGGAGGAGAAGGCATTGTATATGCTCGAGCATATACAATGCCTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030574.2-198s1c1
Sequence:CCGGGCATTGTATATGGGACACTAGCTCGAGCTAGTGTCCCATATACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030574
VALIDATED
STARD5 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030574.2-678s1c1
Sequence:CCGGGCTATCGTTACTTCTTGGCAACTCGAGTTGCCAAGAAGTAACGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030574.2-879s1c1
Sequence:CCGGGAGCCATTCATGTGTTCCAAACTCGAGTTTGGAACACATGAATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030574.2-656s1c1
Sequence:CCGGGTGAAGCAATTCCATGAGTAACTCGAGTTACTCATGGAATTGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030574.2-192s1c1
Sequence:CCGGGAGAAGGCATTGTATATGGGACTCGAGTCCCATATACAATGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030574.2-361s1c1
Sequence:CCGGGCTCATTTCTCCCAGAGATTTCTCGAGAAATCTCTGGGAGAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030574.2-189s1c1
Sequence:CCGGGAGGAGAAGGCATTGTATATGCTCGAGCATATACAATGCCTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030574.2-198s1c1
Sequence:CCGGGCATTGTATATGGGACACTAGCTCGAGCTAGTGTCCCATATACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030574
VALIDATED
STARD5 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030574.2-678s1c1
Sequence:CCGGGCTATCGTTACTTCTTGGCAACTCGAGTTGCCAAGAAGTAACGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030574.2-879s1c1
Sequence:CCGGGAGCCATTCATGTGTTCCAAACTCGAGTTTGGAACACATGAATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148222    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030574.2-656s1c1
Sequence:CCGGGTGAAGCAATTCCATGAGTAACTCGAGTTACTCATGGAATTGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030574.2-192s1c1
Sequence:CCGGGAGAAGGCATTGTATATGGGACTCGAGTCCCATATACAATGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030574.2-361s1c1
Sequence:CCGGGCTCATTTCTCCCAGAGATTTCTCGAGAAATCTCTGGGAGAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030574.2-189s1c1
Sequence:CCGGGAGGAGAAGGCATTGTATATGCTCGAGCATATACAATGCCTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030574.2-198s1c1
Sequence:CCGGGCATTGTATATGGGACACTAGCTCGAGCTAGTGTCCCATATACAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181900
VALIDATED
STARD5 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 5
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000275811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181900.2-439s21c1
Sequence:CCGGTTGGTGCTAGTCAAGAGATATCTCGAGATATCTCTTGACTAGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181900.2-929s21c1
Sequence:CCGGGAGCCATTCATGTGTTCCAAACTCGAGTTTGGAACACATGAATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181900.2-411s21c1
Sequence:CCGGGCTCATTTCTCCCAGAGATTTCTCGAGAAATCTCTGGGAGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181900.2-248s21c1
Sequence:CCGGGCATTGTATATGGGACACTAGCTCGAGCTAGTGTCCCATATACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181900
VALIDATED
STARD5 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 5
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000275811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181900.2-439s21c1
Sequence:CCGGTTGGTGCTAGTCAAGAGATATCTCGAGATATCTCTTGACTAGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181900.2-929s21c1
Sequence:CCGGGAGCCATTCATGTGTTCCAAACTCGAGTTTGGAACACATGAATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181900.2-411s21c1
Sequence:CCGGGCTCATTTCTCCCAGAGATTTCTCGAGAAATCTCTGGGAGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181900.2-248s21c1
Sequence:CCGGGCATTGTATATGGGACACTAGCTCGAGCTAGTGTCCCATATACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181900
VALIDATED
STARD5 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 5
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000275811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181900.2-439s21c1
Sequence:CCGGTTGGTGCTAGTCAAGAGATATCTCGAGATATCTCTTGACTAGCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_181900.2-929s21c1
Sequence:CCGGGAGCCATTCATGTGTTCCAAACTCGAGTTTGGAACACATGAATGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181900.2-411s21c1
Sequence:CCGGGCTCATTTCTCCCAGAGATTTCTCGAGAAATCTCTGGGAGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181900.2-248s21c1
Sequence:CCGGGCATTGTATATGGGACACTAGCTCGAGCTAGTGTCCCATATACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks