EMAIL THIS PAGE TO A FRIEND

STARD6

StAR-related lipid transfer (START) domain containing 6

UniProtKB ID: P59095
Gene ID:
Human(147323) Summary: Cholesterol homeostasis is regulated, at least in part, by sterol regulatory element (SRE)-binding proteins (e.g., SREBP1; MIM 184756) and by liver X receptors (e.g., LXRA; MIM 602423). Upon sterol depletion, LXRs are inactive and SREBPs are cleaved, after which they bind promoter SREs and activate genes involved in cholesterol biosynthesis and uptake. Sterol transport is mediated by vesicles or by soluble protein carriers, such as steroidogenic acute regulatory protein (STAR; MIM 600617). STAR is homologous to a family of proteins containing a 200- to 210-amino acid STAR-related lipid transfer (START) domain, including STARD6 (Soccio et al., 2002 [PubMed 12011452]
Mouse(170461) StAR-related lipid transfer (START) domain containing 6
Rat(291527) StAR-related lipid transfer (START) domain containing 6
naked mole-rat(101708461) StAR-related lipid transfer (START) domain containing 6
domestic guinea pig(100734647) StAR-related lipid transfer (START) domain containing 6
cow(532195) StAR-related lipid transfer (START) domain containing 6
sheep(101114232) StAR-related lipid transfer (START) domain containing 6
domestic cat(101096360) StAR-related lipid transfer (START) domain containing 6
dog(476193) StAR-related lipid transfer (START) domain containing 6
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139171 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139171 Rosetta Predictions human pricing
NM_001007627 Rosetta Predictions rat pricing
NM_029019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364199 predicted 443
2 SASI_Hs01_00030844 predicted 352
3 SASI_Hs01_00030846 predicted 222
4 SASI_Hs02_00364200 predicted 321
5 SASI_Hs01_00030847 predicted 219
6 SASI_Hs01_00030848 predicted 260
7 SASI_Hs01_00030849 predicted 313
8 SASI_Hs01_00030851 predicted 425
9 SASI_Hs02_00364201 predicted 250
10 SASI_Hs02_00364202 predicted 359
11 SASI_Hs01_00030842 predicted 265
12 SASI_Hs01_00030843 predicted 207
13 SASI_Hs01_00030845 predicted 361
14 SASI_Hs01_00030850 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089207 predicted 362
2 SASI_Rn02_00198729 predicted 956
3 SASI_Rn01_00089209 predicted 943
4 SASI_Rn01_00089210 predicted 482
5 SASI_Rn01_00089211 predicted 790
6 SASI_Rn01_00089212 predicted 714
7 SASI_Rn01_00089213 predicted 995
8 SASI_Rn01_00089214 predicted 556
9 SASI_Rn01_00089215 predicted 952
10 SASI_Rn01_00089216 predicted 923
11 SASI_Rn01_00089208 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334767 predicted 681
2 SASI_Mm01_00187269 predicted 525
3 SASI_Mm01_00187271 predicted 535
4 SASI_Mm02_00334768 predicted 624
5 SASI_Mm01_00187272 predicted 1049
6 SASI_Mm01_00187273 predicted 472
7 SASI_Mm02_00334769 predicted 659
8 SASI_Mm01_00187274 predicted 985
9 SASI_Mm01_00187275 predicted 1042
10 SASI_Mm01_00187276 predicted 578
11 SASI_Mm01_00187268 predicted 363
12 SASI_Mm01_00187270 predicted 444
13 SASI_Mm01_00187277 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029019
VALIDATED
STARD6 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029019.3-1197s21c1
Sequence:CCGGGCTGTGCATTCGGATCCTAAACTCGAGTTTAGGATCCGAATGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029019.3-950s21c1
Sequence:CCGGGCCATTAAACCGTAGCGATTTCTCGAGAAATCGCTACGGTTTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029019.2-1170s1c1
Sequence:CCGGCCGTTAATACACTTTGACCATCTCGAGATGGTCAAAGTGTATTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029019.2-686s1c1
Sequence:CCGGCGACTTATATCCGTGGCTTTACTCGAGTAAAGCCACGGATATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029019.2-671s1c1
Sequence:CCGGGATATGCTCCAACTTCGACTTCTCGAGAAGTCGAAGTTGGAGCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029019.2-585s1c1
Sequence:CCGGCCCTAGAGACTTTATCGACTTCTCGAGAAGTCGATAAAGTCTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029019.2-546s1c1
Sequence:CCGGCCACACCATTACACAAAGTTTCTCGAGAAACTTTGTGTAATGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029019
VALIDATED
STARD6 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029019.3-1197s21c1
Sequence:CCGGGCTGTGCATTCGGATCCTAAACTCGAGTTTAGGATCCGAATGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029019.3-950s21c1
Sequence:CCGGGCCATTAAACCGTAGCGATTTCTCGAGAAATCGCTACGGTTTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029019.2-1170s1c1
Sequence:CCGGCCGTTAATACACTTTGACCATCTCGAGATGGTCAAAGTGTATTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029019.2-686s1c1
Sequence:CCGGCGACTTATATCCGTGGCTTTACTCGAGTAAAGCCACGGATATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029019.2-671s1c1
Sequence:CCGGGATATGCTCCAACTTCGACTTCTCGAGAAGTCGAAGTTGGAGCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029019.2-585s1c1
Sequence:CCGGCCCTAGAGACTTTATCGACTTCTCGAGAAGTCGATAAAGTCTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029019.2-546s1c1
Sequence:CCGGCCACACCATTACACAAAGTTTCTCGAGAAACTTTGTGTAATGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029019
VALIDATED
STARD6 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441619    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029019.3-1197s21c1
Sequence:CCGGGCTGTGCATTCGGATCCTAAACTCGAGTTTAGGATCCGAATGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029019.3-950s21c1
Sequence:CCGGGCCATTAAACCGTAGCGATTTCTCGAGAAATCGCTACGGTTTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029019.2-1170s1c1
Sequence:CCGGCCGTTAATACACTTTGACCATCTCGAGATGGTCAAAGTGTATTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029019.2-686s1c1
Sequence:CCGGCGACTTATATCCGTGGCTTTACTCGAGTAAAGCCACGGATATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029019.2-671s1c1
Sequence:CCGGGATATGCTCCAACTTCGACTTCTCGAGAAGTCGAAGTTGGAGCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029019.2-585s1c1
Sequence:CCGGCCCTAGAGACTTTATCGACTTCTCGAGAAGTCGATAAAGTCTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029019.2-546s1c1
Sequence:CCGGCCACACCATTACACAAAGTTTCTCGAGAAACTTTGTGTAATGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139171
STARD6 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139171.1-171s21c1
Sequence:CCGGACCAGCTAAACTATCTGATTTCTCGAGAAATCAGATAGTTTAGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139171.1-143s21c1
Sequence:CCGGATCGTGTTGAAGGGATAATTCCTCGAGGAATTATCCCTTCAACACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139171.1-64s21c1
Sequence:CCGGTCAGGCTGGAAAGTGGTTAAACTCGAGTTTAACCACTTTCCAGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139171.1-103s1c1
Sequence:CCGGGTTTCCAGTAAGGCTTCTAGACTCGAGTCTAGAAGCCTTACTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139171.1-206s1c1
Sequence:CCGGGAGACAGAATTACATGGGATACTCGAGTATCCCATGTAATTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139171.1-419s1c1
Sequence:CCGGCTTCAAATTATATCCGCGGTTCTCGAGAACCGCGGATATAATTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139171.1-483s1c1
Sequence:CCGGCCCAGCATATTCCAAACTAGTCTCGAGACTAGTTTGGAATATGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139171.1-513s1c1
Sequence:CCGGCCAGACAGAAATGAGAGGAAACTCGAGTTTCCTCTCATTTCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139171.1-502s1c1
Sequence:CCGGGTGATGTTTGTCCAGACAGAACTCGAGTTCTGTCTGGACAAACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139171.1-181s1c1
Sequence:CCGGCTATCTGATTTCCTCTACCAACTCGAGTTGGTAGAGGAAATCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139171.1-187s1c1
Sequence:CCGGGATTTCCTCTACCAAACTGGACTCGAGTCCAGTTTGGTAGAGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139171
STARD6 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139171.1-171s21c1
Sequence:CCGGACCAGCTAAACTATCTGATTTCTCGAGAAATCAGATAGTTTAGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139171.1-143s21c1
Sequence:CCGGATCGTGTTGAAGGGATAATTCCTCGAGGAATTATCCCTTCAACACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139171.1-64s21c1
Sequence:CCGGTCAGGCTGGAAAGTGGTTAAACTCGAGTTTAACCACTTTCCAGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139171.1-103s1c1
Sequence:CCGGGTTTCCAGTAAGGCTTCTAGACTCGAGTCTAGAAGCCTTACTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139171.1-206s1c1
Sequence:CCGGGAGACAGAATTACATGGGATACTCGAGTATCCCATGTAATTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139171.1-419s1c1
Sequence:CCGGCTTCAAATTATATCCGCGGTTCTCGAGAACCGCGGATATAATTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139171.1-483s1c1
Sequence:CCGGCCCAGCATATTCCAAACTAGTCTCGAGACTAGTTTGGAATATGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139171.1-513s1c1
Sequence:CCGGCCAGACAGAAATGAGAGGAAACTCGAGTTTCCTCTCATTTCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139171.1-502s1c1
Sequence:CCGGGTGATGTTTGTCCAGACAGAACTCGAGTTCTGTCTGGACAAACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139171.1-181s1c1
Sequence:CCGGCTATCTGATTTCCTCTACCAACTCGAGTTGGTAGAGGAAATCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139171.1-187s1c1
Sequence:CCGGGATTTCCTCTACCAAACTGGACTCGAGTCCAGTTTGGTAGAGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139171
STARD6 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139171.1-171s21c1
Sequence:CCGGACCAGCTAAACTATCTGATTTCTCGAGAAATCAGATAGTTTAGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139171.1-143s21c1
Sequence:CCGGATCGTGTTGAAGGGATAATTCCTCGAGGAATTATCCCTTCAACACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139171.1-64s21c1
Sequence:CCGGTCAGGCTGGAAAGTGGTTAAACTCGAGTTTAACCACTTTCCAGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139171.1-103s1c1
Sequence:CCGGGTTTCCAGTAAGGCTTCTAGACTCGAGTCTAGAAGCCTTACTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139171.1-206s1c1
Sequence:CCGGGAGACAGAATTACATGGGATACTCGAGTATCCCATGTAATTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139171.1-419s1c1
Sequence:CCGGCTTCAAATTATATCCGCGGTTCTCGAGAACCGCGGATATAATTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139171.1-483s1c1
Sequence:CCGGCCCAGCATATTCCAAACTAGTCTCGAGACTAGTTTGGAATATGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139171.1-513s1c1
Sequence:CCGGCCAGACAGAAATGAGAGGAAACTCGAGTTTCCTCTCATTTCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139171.1-502s1c1
Sequence:CCGGGTGATGTTTGTCCAGACAGAACTCGAGTTCTGTCTGGACAAACATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139171.1-181s1c1
Sequence:CCGGCTATCTGATTTCCTCTACCAACTCGAGTTGGTAGAGGAAATCAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139171.1-187s1c1
Sequence:CCGGGATTTCCTCTACCAAACTGGACTCGAGTCCAGTTTGGTAGAGGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks