EMAIL THIS PAGE TO A FRIEND

STARD7

StAR-related lipid transfer (START) domain containing 7

Synonyms: GTT1
UniProtKB ID: Q9NQZ5, D3DXG9, Q53T44, Q6GU43, Q969M6
Gene ID:
Human(56910) Summary: Although the function of this gene is not known, its existence is supported by mRNA and EST data. The predicted gene product contains a region similar to the STAR-related lipid transfer (START) domain, which is often present in proteins involved in the cell signaling mediated by lipid binding. Alternatively spliced transcript variants have been described, although some transcripts occur only in cancer cell lines. [provided by RefSeq, Jul 2008]
Mouse(99138) START domain containing 7
Rat(296128) StAR-related lipid transfer (START) domain containing 7
domestic cat(101090934) StAR-related lipid transfer (START) domain containing 7
Horse(100051542) StAR-related lipid transfer (START) domain containing 7
dog(475744) StAR-related lipid transfer (START) domain containing 7
cow(524966) StAR-related lipid transfer (START) domain containing 7
sheep(101115449) StAR-related lipid transfer (START) domain containing 7
domestic guinea pig(100718775) StAR-related lipid transfer (START) domain containing 7
naked mole-rat(101702631) StAR-related lipid transfer (START) domain containing 7
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139308 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139308 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139308 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020151 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020151 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020151 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020151 Rosetta Predictions human pricing
NM_139267 Rosetta Predictions human pricing
NM_001106503 Rosetta Predictions rat pricing
NM_139308 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051428 predicted 1063
2 SASI_Hs01_00051429 predicted 1559
3 SASI_Hs01_00051430 predicted 880
4 SASI_Hs01_00051432 predicted 1381
5 SASI_Hs01_00051433 predicted 1175
6 SASI_Hs01_00051434 predicted 1091
7 SASI_Hs02_00353044 predicted 1247
8 SASI_Hs01_00051437 predicted 681
9 SASI_Hs02_00353045 predicted 913
10 SASI_Hs02_00353046 predicted 1010
11 SASI_Hs01_00051431 predicted 1372
12 SASI_Hs01_00051435 predicted 822
13 SASI_Hs01_00051436 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041687 predicted 842
2 SASI_Hs01_00041688 predicted 1336
3 SASI_Hs01_00041689 predicted 664
4 SASI_Hs01_00041690 predicted 1150
5 SASI_Hs01_00041691 predicted 1166
6 SASI_Hs01_00041692 predicted 956
7 SASI_Hs01_00041693 predicted 878
8 SASI_Hs01_00041694 predicted 610
9 SASI_Hs01_00041695 predicted 783
10 SASI_Hs01_00041696 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219608 predicted 974
2 SASI_Rn02_00219609 predicted 754
3 SASI_Rn02_00219610 predicted 959
4 SASI_Rn02_00219611 predicted 1058
5 SASI_Rn02_00219612 predicted 667
6 SASI_Rn02_00219613 predicted 1008
7 SASI_Rn02_00219614 predicted 984
8 SASI_Rn02_00219615 predicted 928
9 SASI_Rn02_00219616 predicted 1071
10 SASI_Rn02_00219617 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031033 predicted 1329
2 SASI_Mm01_00031034 predicted 1206
3 SASI_Mm01_00031035 predicted 831
4 SASI_Mm01_00031036 predicted 1261
5 SASI_Mm01_00031037 predicted 702
6 SASI_Mm02_00340010 predicted 1166
7 SASI_Mm01_00031038 predicted 1242
8 SASI_Mm01_00031040 predicted 751
9 SASI_Mm01_00031041 predicted 1013
10 SASI_Mm01_00031042 predicted 958
11 SASI_Mm01_00031039 predicted 1228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139308
VALIDATED
STARD7 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139308.1-2573s1c1
Sequence:CCGGGCTGGTTTCTTTATGGTGAATCTCGAGATTCACCATAAAGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139308.1-662s1c1
Sequence:CCGGCGGTTGGAAGAAATGTCAAATCTCGAGATTTGACATTTCTTCCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139308.1-1015s1c1
Sequence:CCGGTCCAATGTACTCTCGTGATTACTCGAGTAATCACGAGAGTACATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139308.1-1348s1c1
Sequence:CCGGGAAAGACTACATCTCGGCTAACTCGAGTTAGCCGAGATGTAGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139308.1-981s1c1
Sequence:CCGGCTGAGGTTCTTCATTGGGTAACTCGAGTTACCCAATGAAGAACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139308.2-1025s21c1
Sequence:CCGGTCCAATGTACTCTCGTGATTACTCGAGTAATCACGAGAGTACATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139308.2-1358s21c1
Sequence:CCGGGAAAGACTACATCTCGGCTAACTCGAGTTAGCCGAGATGTAGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139308.2-991s21c1
Sequence:CCGGCTGAGGTTCTTCATTGGGTAACTCGAGTTACCCAATGAAGAACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139308.2-2583s21c1
Sequence:CCGGGCTGGTTTCTTTATGGTGAATCTCGAGATTCACCATAAAGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139308.2-672s21c1
Sequence:CCGGCGGTTGGAAGAAATGTCAAATCTCGAGATTTGACATTTCTTCCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139308
VALIDATED
STARD7 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139308.1-2573s1c1
Sequence:CCGGGCTGGTTTCTTTATGGTGAATCTCGAGATTCACCATAAAGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139308.1-662s1c1
Sequence:CCGGCGGTTGGAAGAAATGTCAAATCTCGAGATTTGACATTTCTTCCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139308.1-1015s1c1
Sequence:CCGGTCCAATGTACTCTCGTGATTACTCGAGTAATCACGAGAGTACATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139308.1-1348s1c1
Sequence:CCGGGAAAGACTACATCTCGGCTAACTCGAGTTAGCCGAGATGTAGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139308.1-981s1c1
Sequence:CCGGCTGAGGTTCTTCATTGGGTAACTCGAGTTACCCAATGAAGAACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139308.2-1025s21c1
Sequence:CCGGTCCAATGTACTCTCGTGATTACTCGAGTAATCACGAGAGTACATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139308.2-1358s21c1
Sequence:CCGGGAAAGACTACATCTCGGCTAACTCGAGTTAGCCGAGATGTAGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139308.2-991s21c1
Sequence:CCGGCTGAGGTTCTTCATTGGGTAACTCGAGTTACCCAATGAAGAACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139308.2-2583s21c1
Sequence:CCGGGCTGGTTTCTTTATGGTGAATCTCGAGATTCACCATAAAGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139308.2-672s21c1
Sequence:CCGGCGGTTGGAAGAAATGTCAAATCTCGAGATTTGACATTTCTTCCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139308
VALIDATED
STARD7 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139308.1-2573s1c1
Sequence:CCGGGCTGGTTTCTTTATGGTGAATCTCGAGATTCACCATAAAGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139308.1-662s1c1
Sequence:CCGGCGGTTGGAAGAAATGTCAAATCTCGAGATTTGACATTTCTTCCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139308.1-1015s1c1
Sequence:CCGGTCCAATGTACTCTCGTGATTACTCGAGTAATCACGAGAGTACATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139308.1-1348s1c1
Sequence:CCGGGAAAGACTACATCTCGGCTAACTCGAGTTAGCCGAGATGTAGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139308.1-981s1c1
Sequence:CCGGCTGAGGTTCTTCATTGGGTAACTCGAGTTACCCAATGAAGAACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139308.2-1025s21c1
Sequence:CCGGTCCAATGTACTCTCGTGATTACTCGAGTAATCACGAGAGTACATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139308.2-1358s21c1
Sequence:CCGGGAAAGACTACATCTCGGCTAACTCGAGTTAGCCGAGATGTAGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139308.2-991s21c1
Sequence:CCGGCTGAGGTTCTTCATTGGGTAACTCGAGTTACCCAATGAAGAACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139308.2-2583s21c1
Sequence:CCGGGCTGGTTTCTTTATGGTGAATCTCGAGATTCACCATAAAGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139308.2-672s21c1
Sequence:CCGGCGGTTGGAAGAAATGTCAAATCTCGAGATTTGACATTTCTTCCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020151
VALIDATED
STARD7 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020151.2-2173s1c1
Sequence:CCGGGCCTGCACAATATCACCCATTCTCGAGAATGGGTGATATTGTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020151.2-1055s1c1
Sequence:CCGGCCAATGTACTCACGGGATTATCTCGAGATAATCCCGTGAGTACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020151.2-3093s1c1
Sequence:CCGGCCTGGGTTATGTCCAAACTTACTCGAGTAAGTTTGGACATAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020151.2-940s1c1
Sequence:CCGGGCTGGACACAGAGTATAGAAACTCGAGTTTCTATACTCTGTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020151.2-701s1c1
Sequence:CCGGCGGTTGGAAGAAATGTCAAATCTCGAGATTTGACATTTCTTCCAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_020151.3-711s21c1
Sequence:CCGGCGGTTGGAAGAAATGTCAAATCTCGAGATTTGACATTTCTTCCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_020151.3-1065s21c1
Sequence:CCGGCCAATGTACTCACGGGATTATCTCGAGATAATCCCGTGAGTACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_020151.3-2183s21c1
Sequence:CCGGGCCTGCACAATATCACCCATTCTCGAGAATGGGTGATATTGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020151.3-950s21c1
Sequence:CCGGGCTGGACACAGAGTATAGAAACTCGAGTTTCTATACTCTGTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020151
VALIDATED
STARD7 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020151.2-2173s1c1
Sequence:CCGGGCCTGCACAATATCACCCATTCTCGAGAATGGGTGATATTGTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020151.2-1055s1c1
Sequence:CCGGCCAATGTACTCACGGGATTATCTCGAGATAATCCCGTGAGTACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020151.2-3093s1c1
Sequence:CCGGCCTGGGTTATGTCCAAACTTACTCGAGTAAGTTTGGACATAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020151.2-940s1c1
Sequence:CCGGGCTGGACACAGAGTATAGAAACTCGAGTTTCTATACTCTGTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020151.2-701s1c1
Sequence:CCGGCGGTTGGAAGAAATGTCAAATCTCGAGATTTGACATTTCTTCCAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_020151.3-711s21c1
Sequence:CCGGCGGTTGGAAGAAATGTCAAATCTCGAGATTTGACATTTCTTCCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_020151.3-1065s21c1
Sequence:CCGGCCAATGTACTCACGGGATTATCTCGAGATAATCCCGTGAGTACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_020151.3-2183s21c1
Sequence:CCGGGCCTGCACAATATCACCCATTCTCGAGAATGGGTGATATTGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020151.3-950s21c1
Sequence:CCGGGCTGGACACAGAGTATAGAAACTCGAGTTTCTATACTCTGTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020151
VALIDATED
STARD7 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020151.2-2173s1c1
Sequence:CCGGGCCTGCACAATATCACCCATTCTCGAGAATGGGTGATATTGTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020151.2-1055s1c1
Sequence:CCGGCCAATGTACTCACGGGATTATCTCGAGATAATCCCGTGAGTACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_020151.2-3093s1c1
Sequence:CCGGCCTGGGTTATGTCCAAACTTACTCGAGTAAGTTTGGACATAACCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_020151.2-940s1c1
Sequence:CCGGGCTGGACACAGAGTATAGAAACTCGAGTTTCTATACTCTGTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020151.2-701s1c1
Sequence:CCGGCGGTTGGAAGAAATGTCAAATCTCGAGATTTGACATTTCTTCCAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_020151.3-711s21c1
Sequence:CCGGCGGTTGGAAGAAATGTCAAATCTCGAGATTTGACATTTCTTCCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_020151.3-1065s21c1
Sequence:CCGGCCAATGTACTCACGGGATTATCTCGAGATAATCCCGTGAGTACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280742    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_020151.3-2183s21c1
Sequence:CCGGGCCTGCACAATATCACCCATTCTCGAGAATGGGTGATATTGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020151.3-950s21c1
Sequence:CCGGGCTGGACACAGAGTATAGAAACTCGAGTTTCTATACTCTGTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks