EMAIL THIS PAGE TO A FRIEND

STARD8

StAR-related lipid transfer (START) domain containing 8

Synonyms: ARHGAP38 DLC3 STARTGAP3
UniProtKB ID: Q92502, A8K6T2, D3DVT9, Q5JST0, Q68DG7
Gene ID:
Human(9754) Summary: This gene encodes a member of a subfamily of Rho GTPase activating proteins that contain a steroidogenic acute regulatory protein related lipid transfer domain. The encoded protein localizes to focal adhesions and may be involved in regulating cell morphology. This protein may also function as a tumor suppressor. [provided by RefSeq, Mar 2010]
Mouse(236920) START domain containing 8
Rat(312113) StAR-related lipid transfer (START) domain containing 8
naked mole-rat(101705787) StAR-related lipid transfer (START) domain containing 8
cow(535900) StAR-related lipid transfer (START) domain containing 8
sheep(101120222) StAR-related lipid transfer (START) domain containing 8
Zebrafish(558476) StAR-related lipid transfer (START) domain containing 8
Horse(100066306) StAR-related lipid transfer (START) domain containing 8
domestic cat(101082549) StAR-related lipid transfer (START) domain containing 8
chicken(768976) StAR-related lipid transfer (START) domain containing 8
dog(491932) StAR-related lipid transfer (START) domain containing 8
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014725 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199018 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199018 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199018 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014725 Rosetta Predictions human pricing
NM_001107849 Rosetta Predictions rat pricing
NM_199018 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104559 predicted 2829
2 SASI_Hs01_00104560 predicted 400
3 SASI_Hs01_00104562 predicted 734
4 SASI_Hs01_00104563 predicted 1924
5 SASI_Hs01_00104564 predicted 2682
6 SASI_Hs01_00104565 predicted 2256
7 SASI_Hs01_00104566 predicted 1942
8 SASI_Hs02_00346167 predicted 2187
9 SASI_Hs02_00346168 predicted 2337
10 SASI_Hs02_00346169 predicted 2555
11 SASI_Hs01_00104557 predicted 2481
12 SASI_Hs01_00104558 predicted 1023
13 SASI_Hs01_00104561 predicted 2363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232885 predicted 3235
2 SASI_Rn02_00232886 predicted 1449
3 SASI_Rn02_00232887 predicted 2007
4 SASI_Rn02_00232888 predicted 2227
5 SASI_Rn02_00232889 predicted 1850
6 SASI_Rn02_00232890 predicted 2296
7 SASI_Rn02_00232891 predicted 1694
8 SASI_Rn02_00232892 predicted 353
9 SASI_Rn02_00232893 predicted 504
10 SASI_Rn02_00232894 predicted 2052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199018 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044179 predicted 1833
2 SASI_Mm01_00044180 predicted 1647
3 SASI_Mm01_00044181 predicted 1593
4 SASI_Mm01_00044182 predicted 309
5 SASI_Mm01_00044183 predicted 911
6 SASI_Mm01_00044184 predicted 1822
7 SASI_Mm01_00044185 predicted 834
8 SASI_Mm01_00044186 predicted 633
9 SASI_Mm01_00044187 predicted 2445
10 SASI_Mm01_00044188 predicted 2259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014725
STARD8 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014725.3-2678s21c1
Sequence:CCGGTGATCAGTGACTGCAAGAAACCTCGAGGTTTCTTGCAGTCACTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014725.3-2240s21c1
Sequence:CCGGATGAGACCTCGCCTGACAATGCTCGAGCATTGTCAGGCGAGGTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014725.3-2217s21c1
Sequence:CCGGGATCCAGAACCTGCGTCAAATCTCGAGATTTGACGCAGGTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014725.2-2304s1c1
Sequence:CCGGGCTGACCTGCTAAAGCAGTATCTCGAGATACTGCTTTAGCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014725.2-2477s1c1
Sequence:CCGGGCTCTACTTCTTAAGTGACATCTCGAGATGTCACTTAAGAAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014725.2-766s1c1
Sequence:CCGGGCTTCCTCAAGCACCTTGAATCTCGAGATTCAAGGTGCTTGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014725.2-1865s1c1
Sequence:CCGGCCGTTGGCATAGCTTCCAGAACTCGAGTTCTGGAAGCTATGCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014725.2-3351s1c1
Sequence:CCGGGACTGGTACAACAAAGTCTTTCTCGAGAAAGACTTTGTTGTACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014725
STARD8 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014725.3-2678s21c1
Sequence:CCGGTGATCAGTGACTGCAAGAAACCTCGAGGTTTCTTGCAGTCACTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014725.3-2240s21c1
Sequence:CCGGATGAGACCTCGCCTGACAATGCTCGAGCATTGTCAGGCGAGGTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014725.3-2217s21c1
Sequence:CCGGGATCCAGAACCTGCGTCAAATCTCGAGATTTGACGCAGGTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014725.2-2304s1c1
Sequence:CCGGGCTGACCTGCTAAAGCAGTATCTCGAGATACTGCTTTAGCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014725.2-2477s1c1
Sequence:CCGGGCTCTACTTCTTAAGTGACATCTCGAGATGTCACTTAAGAAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014725.2-766s1c1
Sequence:CCGGGCTTCCTCAAGCACCTTGAATCTCGAGATTCAAGGTGCTTGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014725.2-1865s1c1
Sequence:CCGGCCGTTGGCATAGCTTCCAGAACTCGAGTTCTGGAAGCTATGCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014725.2-3351s1c1
Sequence:CCGGGACTGGTACAACAAAGTCTTTCTCGAGAAAGACTTTGTTGTACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014725
STARD8 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014725.3-2678s21c1
Sequence:CCGGTGATCAGTGACTGCAAGAAACCTCGAGGTTTCTTGCAGTCACTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014725.3-2240s21c1
Sequence:CCGGATGAGACCTCGCCTGACAATGCTCGAGCATTGTCAGGCGAGGTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014725.3-2217s21c1
Sequence:CCGGGATCCAGAACCTGCGTCAAATCTCGAGATTTGACGCAGGTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014725.2-2304s1c1
Sequence:CCGGGCTGACCTGCTAAAGCAGTATCTCGAGATACTGCTTTAGCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014725.2-2477s1c1
Sequence:CCGGGCTCTACTTCTTAAGTGACATCTCGAGATGTCACTTAAGAAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014725.2-766s1c1
Sequence:CCGGGCTTCCTCAAGCACCTTGAATCTCGAGATTCAAGGTGCTTGAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014725.2-1865s1c1
Sequence:CCGGCCGTTGGCATAGCTTCCAGAACTCGAGTTCTGGAAGCTATGCCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014725.2-3351s1c1
Sequence:CCGGGACTGGTACAACAAAGTCTTTCTCGAGAAAGACTTTGTTGTACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199018
STARD8 MISSION shRNA Bacterial Glycerol Stock
StAR-related lipid transfer (START) domain containing 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199018.1-2199s1c1
Sequence:CCGGGCTGATTTACTGAAGCAGTATCTCGAGATACTGCTTCAGTAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199018.1-591s1c1
Sequence:CCGGCCAAGTAACCAACCCTTCCTTCTCGAGAAGGAAGGGTTGGTTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199018.1-3989s1c1
Sequence:CCGGCCCTACTTTGACCCACACTTTCTCGAGAAAGTGTGGGTCAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199018.1-2185s1c1
Sequence:CCGGCGGCCTATGATGTGGCTGATTCTCGAGAATCAGCCACATCATAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199018.1-1838s1c1
Sequence:CCGGCCAGATCAACTTGCTTCACAACTCGAGTTGTGAAGCAAGTTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199018
STARD8 MISSION shRNA shRNA Plasmid DNA
StAR-related lipid transfer (START) domain containing 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199018.1-2199s1c1
Sequence:CCGGGCTGATTTACTGAAGCAGTATCTCGAGATACTGCTTCAGTAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199018.1-591s1c1
Sequence:CCGGCCAAGTAACCAACCCTTCCTTCTCGAGAAGGAAGGGTTGGTTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199018.1-3989s1c1
Sequence:CCGGCCCTACTTTGACCCACACTTTCTCGAGAAAGTGTGGGTCAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199018.1-2185s1c1
Sequence:CCGGCGGCCTATGATGTGGCTGATTCTCGAGAATCAGCCACATCATAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199018.1-1838s1c1
Sequence:CCGGCCAGATCAACTTGCTTCACAACTCGAGTTGTGAAGCAAGTTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199018
STARD8 MISSION shRNA Lentiviral Transduction Particles
StAR-related lipid transfer (START) domain containing 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199018.1-2199s1c1
Sequence:CCGGGCTGATTTACTGAAGCAGTATCTCGAGATACTGCTTCAGTAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199018.1-591s1c1
Sequence:CCGGCCAAGTAACCAACCCTTCCTTCTCGAGAAGGAAGGGTTGGTTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199018.1-3989s1c1
Sequence:CCGGCCCTACTTTGACCCACACTTTCTCGAGAAAGTGTGGGTCAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199018.1-2185s1c1
Sequence:CCGGCGGCCTATGATGTGGCTGATTCTCGAGAATCAGCCACATCATAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199018.1-1838s1c1
Sequence:CCGGCCAGATCAACTTGCTTCACAACTCGAGTTGTGAAGCAAGTTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks