EMAIL THIS PAGE TO A FRIEND

STAT1

signal transducer and activator of transcription 1, 91kDa

Synonyms: CANDF7 ISGF-3 STAT91
Gene ID:
Human(6772) Summary: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. Two alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(20846) signal transducer and activator of transcription 1
Rat(25124) signal transducer and activator of transcription 1
chicken(424044) signal transducer and activator of transcription 1, 91kDa
dog(488449) signal transducer and activator of transcription 1, 91kDa
cow(510814) signal transducer and activator of transcription 1, 91kDa
sheep(100307049) signal transducer and activator of transcription 1, 91kDa
Domestic Rabbit(100343893) signal transducer and activator of transcription 1, 91kDa
naked mole-rat(101718902) signal transducer and activator of transcription 1, 91kDa
domestic guinea pig(100724708) signal transducer and activator of transcription 1, 91kDa
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300133 Anti-phospho-STAT1 (pSer727) antibody produced in rabbit affinity isolated antibody mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504538 Anti-phospho-STAT1 (pSer727) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
S2565 Anti-phospho-STAT1 (pTyr701) antibody produced in rabbit affinity isolated antibody, aqueous glycerol solution rat, human (weaker), mouse
western blot pricing
SAB4300032 Anti-phospho-STAT1 (pTyr701) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB4504539 Anti-phospho-STAT1 (pTyr701) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
SAB1105169 Anti-STAT1 (671-685) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB4300326 Anti-STAT1 (Ab-701) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300441 Anti-STAT1 (Ab-727) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
GW22758 Anti-STAT1 (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
AV33373 Anti-STAT1 (AB1) antibody produced in rabbit affinity isolated antibody bovine, mouse, guinea pig, human, rat, pig, sheep, horse, rabbit, canine
western blot pricing
GW22780 Anti-STAT1 (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
AV33374 Anti-STAT1 (AB2) antibody produced in rabbit affinity isolated antibody mouse, pig, horse, rat, rabbit, human, canine, guinea pig, sheep, bovine
western blot pricing
AV38933 Anti-STAT1 (AB3) antibody produced in rabbit affinity isolated antibody , guinea pig, rabbit, zebrafish, canine, mouse, sheep, pig, human, bovine, rat, horse
immunohistochemistry, western blot pricing
AV38934 Anti-STAT1 (AB4) antibody produced in rabbit affinity isolated antibody bovine, human, rat, horse, mouse, guinea pig, canine, pig, goat, rabbit, sheep
western blot pricing
SAB1406486 Anti-STAT1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA000931 Anti-STAT1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV36979 Anti-STAT1 antibody produced in rabbit IgG fraction of antiserum rat, sheep, canine, rabbit, bovine, horse, pig, guinea pig, human, mouse
western blot pricing
S5683 Anti-STAT1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous glycerol solution human, mouse
immunoprecipitation, western blot pricing
HPA000982 Anti-STAT1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502868 Anti-STAT1, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4502869 Anti-STAT1, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB3500364 Anti-STAT1α antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, rat, mouse
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
WH0006772M1 Monoclonal Anti-STAT1 antibody produced in mouse clone 1A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

Cell Lines

Product # Description Species Add to Cart
 
CLL1158 A549 Cells GFP-STAT1 human pricing

ELISA

Product # Description Species Add to Cart
 
RAB0994 Phosphotyrosine STAT1 ELISA Kit human pricing

Kits

Product # Description Species Add to Cart
 
CS0470 STAT1 ELISA human sufficient for 96 determinations human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009283 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009283 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009283 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007315 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007315 Rosetta Predictions human pricing
NM_139266 Rosetta Predictions human pricing
NM_001034164 Rosetta Predictions rat pricing
NM_032612 Rosetta Predictions rat pricing
NM_009283 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343387 predicted 1950
2 SASI_Hs01_00098937 predicted 1033
3 SASI_Hs02_00343388 predicted 1373
4 SASI_Hs01_00098938 predicted 605
5 SASI_Hs01_00098939 predicted 802
6 SASI_Hs01_00098940 predicted 1237
7 SASI_Hs01_00098941 predicted 1156
8 SASI_Hs01_00098942 predicted 646
9 SASI_Hs01_00098943 predicted 2218
10 SASI_Hs01_00098944 predicted 399
11 SASI_Hs01_00098945 predicted 847
12 SASI_Hs01_00098946 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364253 predicted 1949
2 SASI_Hs01_00108153 predicted 1032
3 SASI_Hs02_00364254 predicted 1368
4 SASI_Hs01_00108154 predicted 612
5 SASI_Hs01_00108155 predicted 798
6 SASI_Hs01_00108156 predicted 1243
7 SASI_Hs01_00108157 predicted 1159
8 SASI_Hs01_00108158 predicted 641
9 SASI_Hs01_00108159 predicted 2218
10 SASI_Hs01_00108160 predicted 408
11 SASI_Hs01_00108161 predicted 845
12 SASI_Hs01_00108162 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034164 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112186 predicted 1150
2 SASI_Rn02_00204016 predicted 2376
3 SASI_Rn01_00112188 predicted 1405
4 SASI_Rn01_00112189 predicted 784
5 SASI_Rn02_00204017 predicted 2430
6 SASI_Rn02_00204018 predicted 2403
7 SASI_Rn02_00204019 predicted 1689
8 SASI_Rn01_00112191 predicted 1476
9 SASI_Rn01_00112192 predicted 551
10 SASI_Rn02_00204020 predicted 2484
11 SASI_Rn01_00112185 predicted 1569
12 SASI_Rn01_00112187 predicted 1148
13 SASI_Rn01_00112190 predicted 695
14 SASI_Rn01_00112193 predicted 757
15 SASI_Rn01_00112194 predicted 2194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265476 predicted 2420
2 SASI_Rn01_00040592 predicted 1145
3 SASI_Rn01_00040594 predicted 1406
4 SASI_Rn01_00040595 predicted 780
5 SASI_Rn02_00265477 predicted 2574
6 SASI_Rn02_00265478 predicted 1689
7 SASI_Rn02_00265479 predicted 2495
8 SASI_Rn01_00040597 predicted 1473
9 SASI_Rn01_00040598 predicted 550
10 SASI_Rn01_00040599 predicted 754
11 SASI_Rn01_00040591 predicted 1566
12 SASI_Rn01_00040593 predicted 1156
13 SASI_Rn01_00040596 predicted 693
14 SASI_Rn01_00040600 predicted 2200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009283 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152790 predicted 1026
2 SASI_Mm01_00152797 predicted 2588
3 SASI_Mm01_00152791 predicted 1624
4 SASI_Mm01_00152792 predicted 1750
5 SASI_Mm02_00315784 predicted 2684
6 SASI_Mm01_00152793 predicted 2634
7 SASI_Mm01_00152794 predicted 1467
8 SASI_Mm01_00152796 predicted 2270
9 SASI_Mm01_00152798 predicted 1949
10 SASI_Mm01_00152799 predicted 2378
11 SASI_Mm01_00152795 predicted 2562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009283
VALIDATED
STAT1 MISSION shRNA Bacterial Glycerol Stock
signal transducer and activator of transcription 1, 91kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009283.2-2298s1c1
Sequence:CCGGGCCGAGAACATACCAGAGAATCTCGAGATTCTCTGGTATGTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009283.2-2253s1c1
Sequence:CCGGGCTGTTACTTTCCCAGATATTCTCGAGAATATCTGGGAAAGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009283.2-1007s1c1
Sequence:CCGGGCTCACTCAGAACACTCTGATCTCGAGATCAGAGTGTTCTGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009283.2-468s1c1
Sequence:CCGGGCTGCCTATGATGTCTCGTTTCTCGAGAAACGAGACATCATAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009283.2-1612s1c1
Sequence:CCGGCCGAAGAACTTCACTCTCTTACTCGAGTAAGAGAGTGAAGTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009283.3-1401s21c1
Sequence:CCGGTTGCAAGAGCTGAACTATAACCTCGAGGTTATAGTTCAGCTCTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009283.3-2374s21c1
Sequence:CCGGACGCCTTTGGGAAGTATTATTCTCGAGAATAATACTTCCCAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009283.3-1213s21c1
Sequence:CCGGCCTATGAGCCCGACCCTATTACTCGAGTAATAGGGTCGGGCTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009283.3-2864s21c1
Sequence:CCGGGGACTAGAGTGCGAGTATTTGCTCGAGCAAATACTCGCACTCTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009283.3-2272s21c1
Sequence:CCGGCTGTTACTTTCCCAGATATTACTCGAGTAATATCTGGGAAAGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009283
VALIDATED
STAT1 MISSION shRNA shRNA Plasmid DNA
signal transducer and activator of transcription 1, 91kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009283.2-2298s1c1
Sequence:CCGGGCCGAGAACATACCAGAGAATCTCGAGATTCTCTGGTATGTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009283.2-2253s1c1
Sequence:CCGGGCTGTTACTTTCCCAGATATTCTCGAGAATATCTGGGAAAGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009283.2-1007s1c1
Sequence:CCGGGCTCACTCAGAACACTCTGATCTCGAGATCAGAGTGTTCTGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009283.2-468s1c1
Sequence:CCGGGCTGCCTATGATGTCTCGTTTCTCGAGAAACGAGACATCATAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009283.2-1612s1c1
Sequence:CCGGCCGAAGAACTTCACTCTCTTACTCGAGTAAGAGAGTGAAGTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009283.3-1401s21c1
Sequence:CCGGTTGCAAGAGCTGAACTATAACCTCGAGGTTATAGTTCAGCTCTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009283.3-2374s21c1
Sequence:CCGGACGCCTTTGGGAAGTATTATTCTCGAGAATAATACTTCCCAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009283.3-1213s21c1
Sequence:CCGGCCTATGAGCCCGACCCTATTACTCGAGTAATAGGGTCGGGCTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009283.3-2864s21c1
Sequence:CCGGGGACTAGAGTGCGAGTATTTGCTCGAGCAAATACTCGCACTCTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009283.3-2272s21c1
Sequence:CCGGCTGTTACTTTCCCAGATATTACTCGAGTAATATCTGGGAAAGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009283
VALIDATED
STAT1 MISSION shRNA Lentiviral Transduction Particles
signal transducer and activator of transcription 1, 91kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009283.2-2298s1c1
Sequence:CCGGGCCGAGAACATACCAGAGAATCTCGAGATTCTCTGGTATGTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009283.2-2253s1c1
Sequence:CCGGGCTGTTACTTTCCCAGATATTCTCGAGAATATCTGGGAAAGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009283.2-1007s1c1
Sequence:CCGGGCTCACTCAGAACACTCTGATCTCGAGATCAGAGTGTTCTGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009283.2-468s1c1
Sequence:CCGGGCTGCCTATGATGTCTCGTTTCTCGAGAAACGAGACATCATAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009283.2-1612s1c1
Sequence:CCGGCCGAAGAACTTCACTCTCTTACTCGAGTAAGAGAGTGAAGTTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009283.3-1401s21c1
Sequence:CCGGTTGCAAGAGCTGAACTATAACCTCGAGGTTATAGTTCAGCTCTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009283.3-2374s21c1
Sequence:CCGGACGCCTTTGGGAAGTATTATTCTCGAGAATAATACTTCCCAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009283.3-1213s21c1
Sequence:CCGGCCTATGAGCCCGACCCTATTACTCGAGTAATAGGGTCGGGCTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009283.3-2864s21c1
Sequence:CCGGGGACTAGAGTGCGAGTATTTGCTCGAGCAAATACTCGCACTCTAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009283.3-2272s21c1
Sequence:CCGGCTGTTACTTTCCCAGATATTACTCGAGTAATATCTGGGAAAGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007315
VALIDATED
STAT1 MISSION shRNA Bacterial Glycerol Stock
signal transducer and activator of transcription 1, 91kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_007315.x-1201s1c1
Sequence:CCGGGAACAGAAATACACCTACGAACTCGAGTTCGTAGGTGTATTTCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_007315.x-2870s1c1
Sequence:CCGGCCCAAAGTATCAGGACGAGAACTCGAGTTCTCGTCCTGATACTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007315.x-2339s1c1
Sequence:CCGGCCCTGAAGTATCTGTATCCAACTCGAGTTGGATACAGATACTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007315.x-2580s1c1
Sequence:CCGGCGACAGTATGATGAACACAGTCTCGAGACTGTGTTCATCATACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007315.x-838s1c1
Sequence:CCGGCTGGAAGATTTACAAGATGAACTCGAGTTCATCTTGTAAATCTTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007315.3-875s21c1
Sequence:CCGGCTGGAAGATTTACAAGATGAACTCGAGTTCATCTTGTAAATCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_007315.3-2617s21c1
Sequence:CCGGCGACAGTATGATGAACACAGTCTCGAGACTGTGTTCATCATACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007315.3-2376s21c1
Sequence:CCGGCCCTGAAGTATCTGTATCCAACTCGAGTTGGATACAGATACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_007315.3-2907s21c1
Sequence:CCGGCCCAAAGTATCAGGACGAGAACTCGAGTTCTCGTCCTGATACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007315
VALIDATED
STAT1 MISSION shRNA shRNA Plasmid DNA
signal transducer and activator of transcription 1, 91kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_007315.x-1201s1c1
Sequence:CCGGGAACAGAAATACACCTACGAACTCGAGTTCGTAGGTGTATTTCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_007315.x-2870s1c1
Sequence:CCGGCCCAAAGTATCAGGACGAGAACTCGAGTTCTCGTCCTGATACTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007315.x-2339s1c1
Sequence:CCGGCCCTGAAGTATCTGTATCCAACTCGAGTTGGATACAGATACTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007315.x-2580s1c1
Sequence:CCGGCGACAGTATGATGAACACAGTCTCGAGACTGTGTTCATCATACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007315.x-838s1c1
Sequence:CCGGCTGGAAGATTTACAAGATGAACTCGAGTTCATCTTGTAAATCTTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007315.3-875s21c1
Sequence:CCGGCTGGAAGATTTACAAGATGAACTCGAGTTCATCTTGTAAATCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_007315.3-2617s21c1
Sequence:CCGGCGACAGTATGATGAACACAGTCTCGAGACTGTGTTCATCATACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007315.3-2376s21c1
Sequence:CCGGCCCTGAAGTATCTGTATCCAACTCGAGTTGGATACAGATACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_007315.3-2907s21c1
Sequence:CCGGCCCAAAGTATCAGGACGAGAACTCGAGTTCTCGTCCTGATACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007315
VALIDATED
STAT1 MISSION shRNA Lentiviral Transduction Particles
signal transducer and activator of transcription 1, 91kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_007315.x-1201s1c1
Sequence:CCGGGAACAGAAATACACCTACGAACTCGAGTTCGTAGGTGTATTTCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_007315.x-2870s1c1
Sequence:CCGGCCCAAAGTATCAGGACGAGAACTCGAGTTCTCGTCCTGATACTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007315.x-2339s1c1
Sequence:CCGGCCCTGAAGTATCTGTATCCAACTCGAGTTGGATACAGATACTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007315.x-2580s1c1
Sequence:CCGGCGACAGTATGATGAACACAGTCTCGAGACTGTGTTCATCATACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007315.x-838s1c1
Sequence:CCGGCTGGAAGATTTACAAGATGAACTCGAGTTCATCTTGTAAATCTTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007315.3-875s21c1
Sequence:CCGGCTGGAAGATTTACAAGATGAACTCGAGTTCATCTTGTAAATCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_007315.3-2617s21c1
Sequence:CCGGCGACAGTATGATGAACACAGTCTCGAGACTGTGTTCATCATACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007315.3-2376s21c1
Sequence:CCGGCCCTGAAGTATCTGTATCCAACTCGAGTTGGATACAGATACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_007315.3-2907s21c1
Sequence:CCGGCCCAAAGTATCAGGACGAGAACTCGAGTTCTCGTCCTGATACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks