EMAIL THIS PAGE TO A FRIEND

STAT2

signal transducer and activator of transcription 2, 113kDa

Synonyms: ISGF-3 P113 STAT113
UniProtKB ID: P52630, B4DLC7, G3V2M6, Q16430, Q16431, Q9UDL4
Gene ID:
Human(6773) Summary: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. In response to interferon (IFN), this protein forms a complex with STAT1 and IFN regulatory factor family protein p48 (ISGF3G), in which this protein acts as a transactivator, but lacks the ability to bind DNA directly. Transcription adaptor P300/CBP (EP300/CREBBP) has been shown to interact specifically with this protein, which is thought to be involved in the process of blocking IFN-alpha response by adenovirus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(20847) signal transducer and activator of transcription 2
Rat(288774) signal transducer and activator of transcription 2
Zebrafish(565200) signal transducer and activator of transcription 2
dog(481111) signal transducer and activator of transcription 2, 113kDa
domestic cat(101099224) signal transducer and activator of transcription 2, 113kDa
domestic guinea pig(100719719) signal transducer and activator of transcription 2, 113kDa
naked mole-rat(101707295) signal transducer and activator of transcription 2, 113kDa
cow(511023) signal transducer and activator of transcription 2, 113kDa
sheep(101108211) signal transducer and activator of transcription 2, 113kDa
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005419 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019963 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019963 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019963 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005419 Rosetta Predictions human pricing
NM_001011905 Rosetta Predictions rat pricing
XM_576139 Rosetta Predictions rat pricing
NM_019963 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111824 predicted 598
2 SASI_Hs01_00111825 predicted 1177
3 SASI_Hs01_00111826 predicted 1690
4 SASI_Hs01_00111828 predicted 821
5 SASI_Hs01_00111829 predicted 1169
6 SASI_Hs01_00111830 predicted 2608
7 SASI_Hs01_00111832 predicted 323
8 SASI_Hs01_00111833 predicted 1271
9 SASI_Hs02_00339558 predicted 2535
10 SASI_Hs02_00339559 predicted 2614
11 SASI_Hs01_00111827 predicted 876
12 SASI_Hs01_00111831 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054592 predicted 649
2 SASI_Rn01_00054593 predicted 1140
3 SASI_Rn01_00054594 predicted 2512
4 SASI_Rn01_00054595 predicted 1738
5 SASI_Rn01_00054596 predicted 395
6 SASI_Rn01_00054598 predicted 971
7 SASI_Rn02_00199897 predicted 1988
8 SASI_Rn01_00054599 predicted 2277
9 SASI_Rn01_00054600 predicted 2573
10 SASI_Rn01_00054601 predicted 202
11 SASI_Rn01_00054597 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00146960 predicted 688
2 SASI_Rn01_00146961 predicted 1181
3 SASI_Rn01_00146962 predicted 2561
4 SASI_Rn01_00146963 predicted 1787
5 SASI_Rn01_00146964 predicted 445
6 SASI_Rn01_00146965 predicted 516
7 SASI_Rn01_00146966 predicted 1013
8 SASI_Rn01_00146967 predicted 2315
9 SASI_Rn01_00146968 predicted 2622
10 SASI_Rn01_00146969 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093702 predicted 1509
2 SASI_Mm01_00093703 predicted 510
3 SASI_Mm01_00093704 predicted 1007
4 SASI_Mm01_00093705 predicted 2199
5 SASI_Mm01_00093706 predicted 2075
6 SASI_Mm01_00093707 predicted 473
7 SASI_Mm01_00093708 predicted 799
8 SASI_Mm01_00093709 predicted 463
9 SASI_Mm01_00093710 predicted 236
10 SASI_Mm01_00093711 predicted 2815
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005419
VALIDATED
STAT2 MISSION shRNA Bacterial Glycerol Stock
signal transducer and activator of transcription 2, 113kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-2001s21c1
Sequence:CCGGGACTGAAATCATCCGCCATTACTCGAGTAATGGCGGATGATTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-1367s21c1
Sequence:CCGGTCATCAGCTTCACGGTCAAATCTCGAGATTTGACCGTGAAGCTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-732s21c1
Sequence:CCGGAGCACTGCTAGGCCGATTAACCTCGAGGTTAATCGGCCTAGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-1665s21c1
Sequence:CCGGTAGGACTGAGGATCCATTATTCTCGAGAATAATGGATCCTCAGTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-591s21c1
Sequence:CCGGTGTCTTCTGCTTCCGATATAACTCGAGTTATATCGGAAGCAGAAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-1426s21c1
Sequence:CCGGACCCTCCCTGTGGTGATTATTCTCGAGAATAATCACCACAGGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005419.2-1724s1c1
Sequence:CCGGGCAAGTTACCATTCTGGACATCTCGAGATGTCCAGAATGGTAACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005419.2-2838s1c1
Sequence:CCGGGCTGAGCCATAGGTCTAAATACTCGAGTATTTAGACCTATGGCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005419.2-1477s1c1
Sequence:CCGGGCTTCAGTTCTCTGGTTCAATCTCGAGATTGAACCAGAGAACTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005419.2-604s1c1
Sequence:CCGGCGATATAAGATCCAGGCCAAACTCGAGTTTGGCCTGGATCTTATATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005419
VALIDATED
STAT2 MISSION shRNA shRNA Plasmid DNA
signal transducer and activator of transcription 2, 113kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-2001s21c1
Sequence:CCGGGACTGAAATCATCCGCCATTACTCGAGTAATGGCGGATGATTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-1367s21c1
Sequence:CCGGTCATCAGCTTCACGGTCAAATCTCGAGATTTGACCGTGAAGCTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-732s21c1
Sequence:CCGGAGCACTGCTAGGCCGATTAACCTCGAGGTTAATCGGCCTAGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-1665s21c1
Sequence:CCGGTAGGACTGAGGATCCATTATTCTCGAGAATAATGGATCCTCAGTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-591s21c1
Sequence:CCGGTGTCTTCTGCTTCCGATATAACTCGAGTTATATCGGAAGCAGAAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-1426s21c1
Sequence:CCGGACCCTCCCTGTGGTGATTATTCTCGAGAATAATCACCACAGGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005419.2-1724s1c1
Sequence:CCGGGCAAGTTACCATTCTGGACATCTCGAGATGTCCAGAATGGTAACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005419.2-2838s1c1
Sequence:CCGGGCTGAGCCATAGGTCTAAATACTCGAGTATTTAGACCTATGGCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005419.2-1477s1c1
Sequence:CCGGGCTTCAGTTCTCTGGTTCAATCTCGAGATTGAACCAGAGAACTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005419.2-604s1c1
Sequence:CCGGCGATATAAGATCCAGGCCAAACTCGAGTTTGGCCTGGATCTTATATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005419
VALIDATED
STAT2 MISSION shRNA Lentiviral Transduction Particles
signal transducer and activator of transcription 2, 113kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-2001s21c1
Sequence:CCGGGACTGAAATCATCCGCCATTACTCGAGTAATGGCGGATGATTTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-1367s21c1
Sequence:CCGGTCATCAGCTTCACGGTCAAATCTCGAGATTTGACCGTGAAGCTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-732s21c1
Sequence:CCGGAGCACTGCTAGGCCGATTAACCTCGAGGTTAATCGGCCTAGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-1665s21c1
Sequence:CCGGTAGGACTGAGGATCCATTATTCTCGAGAATAATGGATCCTCAGTCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-591s21c1
Sequence:CCGGTGTCTTCTGCTTCCGATATAACTCGAGTTATATCGGAAGCAGAAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005419.2-1426s21c1
Sequence:CCGGACCCTCCCTGTGGTGATTATTCTCGAGAATAATCACCACAGGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005419.2-1724s1c1
Sequence:CCGGGCAAGTTACCATTCTGGACATCTCGAGATGTCCAGAATGGTAACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005419.2-2838s1c1
Sequence:CCGGGCTGAGCCATAGGTCTAAATACTCGAGTATTTAGACCTATGGCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005419.2-1477s1c1
Sequence:CCGGGCTTCAGTTCTCTGGTTCAATCTCGAGATTGAACCAGAGAACTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005419.2-604s1c1
Sequence:CCGGCGATATAAGATCCAGGCCAAACTCGAGTTTGGCCTGGATCTTATATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019963
VALIDATED
STAT2 MISSION shRNA Bacterial Glycerol Stock
signal transducer and activator of transcription 2, 113kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019963.1-808s21c1
Sequence:CCGGAGGACTGGTTGGCCGATTAACCTCGAGGTTAATCGGCCAACCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019963.1-3207s21c1
Sequence:CCGGTTCAGGTTGGAACGACTTTAACTCGAGTTAAAGTCGTTCCAACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019963.1-2006s21c1
Sequence:CCGGGATGACGATAAAGTCGAAATCCTCGAGGATTTCGACTTTATCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019963.1-1325s21c1
Sequence:CCGGGGCCAGAGACAGGGCTTAATTCTCGAGAATTAAGCCCTGTCTCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019963.1-1004s21c1
Sequence:CCGGAGTCACATGCTTCGGTATAAGCTCGAGCTTATACCGAAGCATGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019963.1-4197s1c1
Sequence:CCGGCCGGCCAACAGGTGAAATTAACTCGAGTTAATTTCACCTGTTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019963.1-1061s1c1
Sequence:CCGGGCCCAAGTCATGGAGTTACTTCTCGAGAAGTAACTCCATGACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019963.1-1952s1c1
Sequence:CCGGCGCTTCAGTGAAACTTCTGAACTCGAGTTCAGAAGTTTCACTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019963.1-2719s1c1
Sequence:CCGGGCAGCCATCAGAGTCAGATTTCTCGAGAAATCTGACTCTGATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019963.1-2039s1c1
Sequence:CCGGCCCTACACCAAGGAAGTGTTACTCGAGTAACACTTCCTTGGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019963
VALIDATED
STAT2 MISSION shRNA shRNA Plasmid DNA
signal transducer and activator of transcription 2, 113kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019963.1-808s21c1
Sequence:CCGGAGGACTGGTTGGCCGATTAACCTCGAGGTTAATCGGCCAACCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019963.1-3207s21c1
Sequence:CCGGTTCAGGTTGGAACGACTTTAACTCGAGTTAAAGTCGTTCCAACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019963.1-2006s21c1
Sequence:CCGGGATGACGATAAAGTCGAAATCCTCGAGGATTTCGACTTTATCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019963.1-1325s21c1
Sequence:CCGGGGCCAGAGACAGGGCTTAATTCTCGAGAATTAAGCCCTGTCTCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019963.1-1004s21c1
Sequence:CCGGAGTCACATGCTTCGGTATAAGCTCGAGCTTATACCGAAGCATGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019963.1-4197s1c1
Sequence:CCGGCCGGCCAACAGGTGAAATTAACTCGAGTTAATTTCACCTGTTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019963.1-1061s1c1
Sequence:CCGGGCCCAAGTCATGGAGTTACTTCTCGAGAAGTAACTCCATGACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019963.1-1952s1c1
Sequence:CCGGCGCTTCAGTGAAACTTCTGAACTCGAGTTCAGAAGTTTCACTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019963.1-2719s1c1
Sequence:CCGGGCAGCCATCAGAGTCAGATTTCTCGAGAAATCTGACTCTGATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019963.1-2039s1c1
Sequence:CCGGCCCTACACCAAGGAAGTGTTACTCGAGTAACACTTCCTTGGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019963
VALIDATED
STAT2 MISSION shRNA Lentiviral Transduction Particles
signal transducer and activator of transcription 2, 113kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019963.1-808s21c1
Sequence:CCGGAGGACTGGTTGGCCGATTAACCTCGAGGTTAATCGGCCAACCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232261    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019963.1-3207s21c1
Sequence:CCGGTTCAGGTTGGAACGACTTTAACTCGAGTTAAAGTCGTTCCAACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019963.1-2006s21c1
Sequence:CCGGGATGACGATAAAGTCGAAATCCTCGAGGATTTCGACTTTATCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019963.1-1325s21c1
Sequence:CCGGGGCCAGAGACAGGGCTTAATTCTCGAGAATTAAGCCCTGTCTCTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019963.1-1004s21c1
Sequence:CCGGAGTCACATGCTTCGGTATAAGCTCGAGCTTATACCGAAGCATGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019963.1-4197s1c1
Sequence:CCGGCCGGCCAACAGGTGAAATTAACTCGAGTTAATTTCACCTGTTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019963.1-1061s1c1
Sequence:CCGGGCCCAAGTCATGGAGTTACTTCTCGAGAAGTAACTCCATGACTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019963.1-1952s1c1
Sequence:CCGGCGCTTCAGTGAAACTTCTGAACTCGAGTTCAGAAGTTTCACTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019963.1-2719s1c1
Sequence:CCGGGCAGCCATCAGAGTCAGATTTCTCGAGAAATCTGACTCTGATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019963.1-2039s1c1
Sequence:CCGGCCCTACACCAAGGAAGTGTTACTCGAGTAACACTTCCTTGGTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks