EMAIL THIS PAGE TO A FRIEND

STAT3

signal transducer and activator of transcription 3 (acute-phase response factor)

Synonyms: APRF HIES
UniProtKB ID: P40763, A8K7B8, O14916, Q9BW54
Gene ID:
Human(6774) Summary: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Three alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(20848) signal transducer and activator of transcription 3
Rat(25125) signal transducer and activator of transcription 3 (acute-phase response factor)
cow(508541) signal transducer and activator of transcription 3 (acute-phase response factor)
sheep(100294659) signal transducer and activator of transcription 3 (acute-phase response factor)
naked mole-rat(101721899) signal transducer and activator of transcription 3 (acute-phase response factor)
Domestic Rabbit(100348778) signal transducer and activator of transcription 3 (acute-phase response factor)
domestic guinea pig(100717084) signal transducer and activator of transcription 3 (acute-phase response factor)
Zebrafish(30767) signal transduction and activation of transcription 3
Horse(100052852) signal transducer and activator of transcription 3 (acute-phase response factor)
domestic cat(101095698) signal transducer and activator of transcription 3 (acute-phase response factor)
dog(490967) signal transducer and activator of transcription 3 (acute-phase response factor)
chicken(420027) signal transducer and activator of transcription 3 (acute-phase response factor)
279 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300034 Anti-phospho-STAT3 (pSer727) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4504540 Anti-phospho-STAT3 (pSer727) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
S2690 Anti-phospho-STAT3 (pTyr705) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
western blot pricing
SAB4300033 Anti-phospho-STAT3 (pTyr705) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4504541 Anti-phospho-STAT3 (pTyr705) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4300708 Anti-STAT3 (Ab-705) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300327 Anti-STAT3 (Ab-727) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
GW22759 Anti-STAT3 antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, mouse, human
western blot pricing
SAB2500993 Anti-STAT3 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human, mouse, rat
ELISA, western blot pricing
SAB1406487 Anti-STAT3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA001671 Anti-STAT3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2102317 Anti-STAT3 antibody produced in rabbit affinity isolated antibody horse, bovine, mouse, human, canine, pig, rat, guinea pig, rabbit, zebrafish
western blot pricing
S5933 Anti-STAT3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, rat, human
immunocytochemistry, immunoprecipitation, western blot pricing
HPA058603 Anti-STAT3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2104461 Anti-STAT3 antibody produced in rabbit affinity isolated antibody sheep, canine, human, rat, bovine, guinea pig, pig, mouse, horse, rabbit
western blot pricing
SAB2104912 Anti-STAT3 antibody produced in rabbit affinity isolated antibody human, rabbit, sheep, horse, guinea pig
western blot pricing
SAB4502871 Anti-STAT3, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4502872 Anti-STAT3, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4502873 Anti-STAT3, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
WH0006774M2 Monoclonal Anti-STAT3 antibody produced in mouse clone 4D6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB3300114 Monoclonal Anti-STAT3 antibody produced in mouse clone 21E7, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90777 Monoclonal Anti-STAT3 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0492, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90776 Monoclonal Anti-STAT3 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0490, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1404414 Monoclonal Anti-STAT3 antibody produced in mouse clone 1D11-2A11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0255 Rabbit anti-STAT3 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rat, primate, marmoset, gorilla, mouse, horse, rhesus monkey, pig, chimpanzee, human, bovine
immunoprecipitation, proximity ligation assay pricing

Cell Lines

Product # Description Species Add to Cart
 
CLL1140 A549 Cells RFP-STAT3 human pricing
CLL1139 SKOV3 Cells GFP-STAT3 human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011486 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011486 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011486 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003150 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003150 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003150 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
07-703 Anti-phospho-STAT3 (Ser727) Antibody 100 µL, Anti-phospho-STAT3 (Ser727) Antibody is a Rabbit Polyclonal Antibody for detection of phospho-STAT3 (Ser727) also known as Signal Transducer & Activator of Transcription 3 & has been tested in WB. pricing
07-1347 Anti-phospho-STAT3 (Tyr68) Antibody 100 µg, Detect phospho-STAT3 (Tyr68) using this Anti-phospho-STAT3 (Tyr68) Antibody validated for use in WB. pricing
05-485 Anti-phospho-STAT3 (Tyr705) Antibody, clone 9E12 100 µg, Use Anti-phospho-STAT3 (Tyr705) Antibody, clone 9E12 (Mouse Monoclonal Antibody) validated in ELISA, IP, WB to detect phospho-STAT3 (Tyr705) also known as Acute-phase response factor or DNA-binding protein APRF. This Stat3 Antibody has been validated in Human, Mouse and Canine samples. pricing
07-2173 Anti-Stat3 Antibody 100 µg, Use Anti-Stat3 Antibody (rabbit polyclonal antibody) validated in WB, IP to detect Stat3 also known as Acute-phase response factor, DNA-binding protein APRF, signal transducer & activator of transcription 3. pricing
MABC1177 Anti-Stat3b Antibody, clone 516 G10H9 100 μg, Anti-Stat3b Antibody, clone 516 G10H9 is an antibody against Stat3b for use in Western Blotting, Immunoprecipitation. pricing
ABE1397 Anti-trimethyl STAT3 (Lys180) Antibody 100 µL, This Anti-trimethyl STAT3 (Lys180) Antibody is validated for use in Western Blotting, Peptide Inhibition Assay, Immunoprecipitation for the detection of trimethyl STAT3 (Lys180). pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003150 siRNAs that have been validated in the lab human pricing
NM_139276 siRNAs that have been validated in the lab human pricing
NM_213662 siRNAs that have been validated in the lab human pricing
NM_012747 Rosetta Predictions rat pricing
NM_011486 Rosetta Predictions mouse pricing
NM_213659 Rosetta Predictions mouse pricing
NM_213660 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003150 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121206 validated 1014
2 SASI_Hs01_00121207 predicted 1963
3 SASI_Hs01_00121208 predicted 1788
4 SASI_Hs01_00121209 predicted 487
5 SASI_Hs01_00121211 predicted 2033
6 SASI_Hs01_00121212 predicted 1546
7 SASI_Hs02_00335154 predicted 449
8 SASI_Hs01_00121213 predicted 1536
9 SASI_Hs01_00121214 predicted 491
10 SASI_Hs01_00121215 predicted 544
11 SASI_Hs01_00121210 predicted 1617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139276 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061860 validated 1029
2 SASI_Hs01_00061861 predicted 1981
3 SASI_Hs01_00061862 predicted 1810
4 SASI_Hs01_00061863 predicted 515
5 SASI_Hs01_00061865 predicted 2053
6 SASI_Hs01_00061866 predicted 1568
7 SASI_Hs02_00364256 predicted 478
8 SASI_Hs01_00061867 predicted 1556
9 SASI_Hs01_00061868 predicted 511
10 SASI_Hs01_00061869 predicted 569
11 SASI_Hs01_00061864 predicted 1633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213662 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031658 validated 925
2 SASI_Hs01_00031659 predicted 1873
3 SASI_Hs01_00031660 predicted 1702
4 SASI_Hs01_00031661 predicted 404
5 SASI_Hs01_00031663 predicted 1949
6 SASI_Hs01_00031664 predicted 1462
7 SASI_Hs02_00374355 predicted 366
8 SASI_Hs01_00031665 predicted 1442
9 SASI_Hs01_00031666 predicted 403
10 SASI_Hs01_00031667 predicted 454
11 SASI_Hs01_00031662 predicted 1524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110178 predicted 335
2 SASI_Rn01_00110179 predicted 1629
3 SASI_Rn01_00110180 predicted 2454
4 SASI_Rn01_00110181 predicted 998
5 SASI_Rn01_00110182 predicted 1947
6 SASI_Rn01_00110183 predicted 1825
7 SASI_Rn01_00110184 predicted 1607
8 SASI_Rn02_00260103 predicted 1472
9 SASI_Rn01_00110185 predicted 325
10 SASI_Rn01_00110186 predicted 1675
11 SASI_Rn01_00110187 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011486 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041174 predicted 1343
2 SASI_Mm01_00041175 predicted 1541
3 SASI_Mm01_00041176 predicted 1701
4 SASI_Mm02_00320775 predicted 398
5 SASI_Mm01_00041178 predicted 1305
6 SASI_Mm01_00041179 predicted 1067
7 SASI_Mm01_00041180 predicted 462
8 SASI_Mm01_00041181 predicted 493
9 SASI_Mm01_00041182 predicted 2025
10 SASI_Mm01_00041183 predicted 522
11 SASI_Mm01_00041177 predicted 2140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106320 predicted 1348
2 SASI_Mm01_00106321 predicted 1546
3 SASI_Mm01_00106322 predicted 1697
4 SASI_Mm02_00352297 predicted 403
5 SASI_Mm01_00106324 predicted 1304
6 SASI_Mm01_00106325 predicted 1071
7 SASI_Mm01_00106326 predicted 458
8 SASI_Mm01_00106327 predicted 500
9 SASI_Mm01_00106328 predicted 2021
10 SASI_Mm01_00106329 predicted 524
11 SASI_Mm01_00106323 predicted 2134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213660 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122122 predicted 1340
2 SASI_Mm01_00122123 predicted 1548
3 SASI_Mm01_00122124 predicted 1697
4 SASI_Mm02_00352298 predicted 405
5 SASI_Mm01_00122126 predicted 1302
6 SASI_Mm01_00122127 predicted 1075
7 SASI_Mm01_00122128 predicted 454
8 SASI_Mm01_00122129 predicted 498
9 SASI_Mm01_00122130 predicted 2020
10 SASI_Mm01_00122131 predicted 524
11 SASI_Mm01_00122125 predicted 2134
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011486
VALIDATED
STAT3 MISSION shRNA Bacterial Glycerol Stock
signal transducer and activator of transcription 3 (acute-phase response factor)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011486.3-2527s1c1
Sequence:CCGGCCTAACTTTGTGGTTCCAGATCTCGAGATCTGGAACCACAAAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011486.3-1238s1c1
Sequence:CCGGCCTGAGTTGAATTATCAGCTTCTCGAGAAGCTGATAATTCAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011486.3-447s1c1
Sequence:CCGGGCAGGTATCTTGAGAAGCCAACTCGAGTTGGCTTCTCAAGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011486.3-2313s1c1
Sequence:CCGGCACCATTCATTGATGCAGTTTCTCGAGAAACTGCATCAATGAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011486.3-682s1c1
Sequence:CCGGCGACTTTGATTTCAACTACAACTCGAGTTGTAGTTGAAATCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011486.4-2634s21c1
Sequence:CCGGCCTAACTTTGTGGTTCCAGATCTCGAGATCTGGAACCACAAAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011486.4-1345s21c1
Sequence:CCGGCCTGAGTTGAATTATCAGCTTCTCGAGAAGCTGATAATTCAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011486.4-789s21c1
Sequence:CCGGCGACTTTGATTTCAACTACAACTCGAGTTGTAGTTGAAATCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011486.4-554s21c1
Sequence:CCGGGCAGGTATCTTGAGAAGCCAACTCGAGTTGGCTTCTCAAGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011486
VALIDATED
STAT3 MISSION shRNA shRNA Plasmid DNA
signal transducer and activator of transcription 3 (acute-phase response factor)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011486.3-2527s1c1
Sequence:CCGGCCTAACTTTGTGGTTCCAGATCTCGAGATCTGGAACCACAAAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011486.3-1238s1c1
Sequence:CCGGCCTGAGTTGAATTATCAGCTTCTCGAGAAGCTGATAATTCAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011486.3-447s1c1
Sequence:CCGGGCAGGTATCTTGAGAAGCCAACTCGAGTTGGCTTCTCAAGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011486.3-2313s1c1
Sequence:CCGGCACCATTCATTGATGCAGTTTCTCGAGAAACTGCATCAATGAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011486.3-682s1c1
Sequence:CCGGCGACTTTGATTTCAACTACAACTCGAGTTGTAGTTGAAATCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011486.4-2634s21c1
Sequence:CCGGCCTAACTTTGTGGTTCCAGATCTCGAGATCTGGAACCACAAAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011486.4-1345s21c1
Sequence:CCGGCCTGAGTTGAATTATCAGCTTCTCGAGAAGCTGATAATTCAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011486.4-789s21c1
Sequence:CCGGCGACTTTGATTTCAACTACAACTCGAGTTGTAGTTGAAATCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011486.4-554s21c1
Sequence:CCGGGCAGGTATCTTGAGAAGCCAACTCGAGTTGGCTTCTCAAGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011486
VALIDATED
STAT3 MISSION shRNA Lentiviral Transduction Particles
signal transducer and activator of transcription 3 (acute-phase response factor)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011486.3-2527s1c1
Sequence:CCGGCCTAACTTTGTGGTTCCAGATCTCGAGATCTGGAACCACAAAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011486.3-1238s1c1
Sequence:CCGGCCTGAGTTGAATTATCAGCTTCTCGAGAAGCTGATAATTCAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011486.3-447s1c1
Sequence:CCGGGCAGGTATCTTGAGAAGCCAACTCGAGTTGGCTTCTCAAGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011486.3-2313s1c1
Sequence:CCGGCACCATTCATTGATGCAGTTTCTCGAGAAACTGCATCAATGAATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011486.3-682s1c1
Sequence:CCGGCGACTTTGATTTCAACTACAACTCGAGTTGTAGTTGAAATCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011486.4-2634s21c1
Sequence:CCGGCCTAACTTTGTGGTTCCAGATCTCGAGATCTGGAACCACAAAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011486.4-1345s21c1
Sequence:CCGGCCTGAGTTGAATTATCAGCTTCTCGAGAAGCTGATAATTCAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011486.4-789s21c1
Sequence:CCGGCGACTTTGATTTCAACTACAACTCGAGTTGTAGTTGAAATCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011486.4-554s21c1
Sequence:CCGGGCAGGTATCTTGAGAAGCCAACTCGAGTTGGCTTCTCAAGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003150
VALIDATED
STAT3 MISSION shRNA Bacterial Glycerol Stock
signal transducer and activator of transcription 3 (acute-phase response factor)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003150.2-3170s1c1
Sequence:CCGGCGGATCATAAGGTCAGGAGATCTCGAGATCTCCTGACCTTATGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003150.2-361s1c1
Sequence:CCGGGCAAAGAATCACATGCCACTTCTCGAGAAGTGGCATGTGATTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003150.2-1664s1c1
Sequence:CCGGGCTGACCAACAATCCCAAGAACTCGAGTTCTTGGGATTGTTGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003150.2-2169s1c1
Sequence:CCGGGCTGAAATCATCATGGGCTATCTCGAGATAGCCCATGATGATTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003150.3-1350s21c1
Sequence:CCGGCTCAGAGGATCCCGGAAATTTCTCGAGAAATTTCCGGGATCCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003150.3-2613s21c1
Sequence:CCGGCATCTGAAACTACTAACTTTGCTCGAGCAAAGTTAGTAGTTTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003150.3-361s21c1
Sequence:CCGGGCAAAGAATCACATGCCACTTCTCGAGAAGTGGCATGTGATTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003150.3-458s21c1
Sequence:CCGGGCACAATCTACGAAGAATCAACTCGAGTTGATTCTTCGTAGATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_003150.3-1242s21c1
Sequence:CCGGGGCGTCCAGTTCACTACTAAACTCGAGTTTAGTAGTGAACTGGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003150
VALIDATED
STAT3 MISSION shRNA shRNA Plasmid DNA
signal transducer and activator of transcription 3 (acute-phase response factor)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003150.2-3170s1c1
Sequence:CCGGCGGATCATAAGGTCAGGAGATCTCGAGATCTCCTGACCTTATGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003150.2-361s1c1
Sequence:CCGGGCAAAGAATCACATGCCACTTCTCGAGAAGTGGCATGTGATTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003150.2-1664s1c1
Sequence:CCGGGCTGACCAACAATCCCAAGAACTCGAGTTCTTGGGATTGTTGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003150.2-2169s1c1
Sequence:CCGGGCTGAAATCATCATGGGCTATCTCGAGATAGCCCATGATGATTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003150.3-1350s21c1
Sequence:CCGGCTCAGAGGATCCCGGAAATTTCTCGAGAAATTTCCGGGATCCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003150.3-2613s21c1
Sequence:CCGGCATCTGAAACTACTAACTTTGCTCGAGCAAAGTTAGTAGTTTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003150.3-361s21c1
Sequence:CCGGGCAAAGAATCACATGCCACTTCTCGAGAAGTGGCATGTGATTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003150.3-458s21c1
Sequence:CCGGGCACAATCTACGAAGAATCAACTCGAGTTGATTCTTCGTAGATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_003150.3-1242s21c1
Sequence:CCGGGGCGTCCAGTTCACTACTAAACTCGAGTTTAGTAGTGAACTGGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003150
VALIDATED
STAT3 MISSION shRNA Lentiviral Transduction Particles
signal transducer and activator of transcription 3 (acute-phase response factor)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003150.2-3170s1c1
Sequence:CCGGCGGATCATAAGGTCAGGAGATCTCGAGATCTCCTGACCTTATGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003150.2-361s1c1
Sequence:CCGGGCAAAGAATCACATGCCACTTCTCGAGAAGTGGCATGTGATTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003150.2-1664s1c1
Sequence:CCGGGCTGACCAACAATCCCAAGAACTCGAGTTCTTGGGATTGTTGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003150.2-2169s1c1
Sequence:CCGGGCTGAAATCATCATGGGCTATCTCGAGATAGCCCATGATGATTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003150.3-1350s21c1
Sequence:CCGGCTCAGAGGATCCCGGAAATTTCTCGAGAAATTTCCGGGATCCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329811    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_003150.3-2613s21c1
Sequence:CCGGCATCTGAAACTACTAACTTTGCTCGAGCAAAGTTAGTAGTTTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003150.3-361s21c1
Sequence:CCGGGCAAAGAATCACATGCCACTTCTCGAGAAGTGGCATGTGATTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003150.3-458s21c1
Sequence:CCGGGCACAATCTACGAAGAATCAACTCGAGTTGATTCTTCGTAGATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_003150.3-1242s21c1
Sequence:CCGGGGCGTCCAGTTCACTACTAAACTCGAGTTTAGTAGTGAACTGGACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks