EMAIL THIS PAGE TO A FRIEND

STAT4

signal transducer and activator of transcription 4

Synonyms: SLEB11
UniProtKB ID: Q14765, Q96NZ6
Gene ID:
Human(6775) Summary: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is essential for mediating responses to IL12 in lymphocytes, and regulating the differentiation of T helper cells. Mutations in this gene may be associated with systemic lupus erythematosus and rheumatoid arthritis. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Aug 2011]
Mouse(20849) signal transducer and activator of transcription 4
Rat(367264) signal transducer and activator of transcription 4
Zebrafish(368519) signal transducer and activator of transcription 4
chicken(768406) signal transducer and activator of transcription 4
dog(478845) signal transducer and activator of transcription 4
domestic cat(101080650) signal transducer and activator of transcription 4
Horse(100054693) signal transducer and activator of transcription 4
domestic guinea pig(100726892) signal transducer and activator of transcription 4
Domestic Rabbit(100344146) signal transducer and activator of transcription 4
naked mole-rat(101718558) signal transducer and activator of transcription 4
cow(515988) signal transducer and activator of transcription 4
sheep(101117562) signal transducer and activator of transcription 4
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300035 Anti-phospho-STAT4 (pTyr693) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4504542 Anti-phospho-STAT4 (pTyr693) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunoprecipitation, western blot pricing
SAB4300328 Anti-STAT4 (Ab-693) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
GW22786 Anti-STAT4 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2501629 Anti-STAT4 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human, pig
ELISA, western blot pricing
SAB2501630 Anti-STAT4 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA001860 Anti-STAT4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV33376 Anti-STAT4 antibody produced in rabbit IgG fraction of antiserum canine, rat, human, mouse, bovine, pig, rabbit, horse
immunohistochemistry, western blot pricing
SAB4502874 Anti-STAT4, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
WH0006775M1 Monoclonal Anti-STAT4 antibody produced in mouse clone 1C2-1C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404415 Monoclonal Anti-STAT4 antibody produced in mouse clone 2H4-1G8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011487 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011487 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011487 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003151 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003151 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003151 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003151 Rosetta Predictions human pricing
NM_001012226 Rosetta Predictions rat pricing
XM_576563 Rosetta Predictions rat pricing
NM_011487 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175604 predicted 1257
2 SASI_Hs01_00175605 predicted 1868
3 SASI_Hs01_00175606 predicted 2465
4 SASI_Hs01_00175608 predicted 257
5 SASI_Hs01_00175609 predicted 1071
6 SASI_Hs01_00175610 predicted 2227
7 SASI_Hs01_00175611 predicted 1506
8 SASI_Hs01_00175612 predicted 895
9 SASI_Hs01_00175613 predicted 1763
10 SASI_Hs02_00335155 predicted 2498
11 SASI_Hs01_00175607 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012226 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056753 predicted 1779
2 SASI_Rn01_00056754 predicted 1059
3 SASI_Rn01_00056756 predicted 698
4 SASI_Rn01_00056757 predicted 2745
5 SASI_Rn01_00056758 predicted 1607
6 SASI_Rn02_00200485 predicted 717
7 SASI_Rn01_00056759 predicted 1583
8 SASI_Rn01_00056760 predicted 1877
9 SASI_Rn01_00056761 predicted 2047
10 SASI_Rn01_00056762 predicted 2672
11 SASI_Rn01_00056755 predicted 1831
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00192013 predicted 276
2 SASI_Rn01_00192014 predicted 368
3 SASI_Rn01_00192015 predicted 348
4 SASI_Rn01_00192016 predicted 307
5 SASI_Rn01_00192017 predicted 448
6 SASI_Rn01_00192018 predicted 304
7 SASI_Rn01_00192019 predicted 2228
8 SASI_Rn01_00192020 predicted 2272
9 SASI_Rn01_00192021 predicted 367
10 SASI_Rn01_00192022 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134501 predicted 1790
2 SASI_Mm01_00134502 predicted 1396
3 SASI_Mm02_00320776 predicted 1835
4 SASI_Mm01_00134503 predicted 713
5 SASI_Mm01_00134504 predicted 1595
6 SASI_Mm01_00134505 predicted 1116
7 SASI_Mm01_00134506 predicted 2059
8 SASI_Mm01_00134507 predicted 2192
9 SASI_Mm01_00134508 predicted 2685
10 SASI_Mm01_00134509 predicted 1825
11 SASI_Mm01_00134510 predicted 954
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011487
STAT4 MISSION shRNA Bacterial Glycerol Stock
signal transducer and activator of transcription 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011487.4-2151s21c1
Sequence:CCGGAGCAATATTGGACCTAATTAACTCGAGTTAATTAGGTCCAATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011487.4-717s21c1
Sequence:CCGGGCTATTGATTCACAATCTAAACTCGAGTTTAGATTGTGAATCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011487.4-2785s21c1
Sequence:CCGGCTTTACCATAGATCACAATTTCTCGAGAAATTGTGATCTATGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011487.4-1321s21c1
Sequence:CCGGCTACAGGAGCAATCTACTAAACTCGAGTTTAGTAGATTGCTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011487.4-2733s21c1
Sequence:CCGGACGGTGCAAACGGACACTTTACTCGAGTAAAGTGTCCGTTTGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011487.1-1077s1c1
Sequence:CCGGCGCTGCAAGAAATGCTTAATACTCGAGTATTAAGCATTTCTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011487.1-1568s1c1
Sequence:CCGGGCGTCCATTGACAAGAATGTTCTCGAGAACATTCTTGTCAATGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011487.1-2814s1c1
Sequence:CCGGCGGCTTTGTAAATACCAGTTTCTCGAGAAACTGGTATTTACAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011487.1-2413s1c1
Sequence:CCGGGCGAGACTACAAGGTTATCATCTCGAGATGATAACCTTGTAGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011487.1-1569s1c1
Sequence:CCGGCGTCCATTGACAAGAATGTTTCTCGAGAAACATTCTTGTCAATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011487
STAT4 MISSION shRNA shRNA Plasmid DNA
signal transducer and activator of transcription 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011487.4-2151s21c1
Sequence:CCGGAGCAATATTGGACCTAATTAACTCGAGTTAATTAGGTCCAATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011487.4-717s21c1
Sequence:CCGGGCTATTGATTCACAATCTAAACTCGAGTTTAGATTGTGAATCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011487.4-2785s21c1
Sequence:CCGGCTTTACCATAGATCACAATTTCTCGAGAAATTGTGATCTATGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011487.4-1321s21c1
Sequence:CCGGCTACAGGAGCAATCTACTAAACTCGAGTTTAGTAGATTGCTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011487.4-2733s21c1
Sequence:CCGGACGGTGCAAACGGACACTTTACTCGAGTAAAGTGTCCGTTTGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011487.1-1077s1c1
Sequence:CCGGCGCTGCAAGAAATGCTTAATACTCGAGTATTAAGCATTTCTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011487.1-1568s1c1
Sequence:CCGGGCGTCCATTGACAAGAATGTTCTCGAGAACATTCTTGTCAATGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011487.1-2814s1c1
Sequence:CCGGCGGCTTTGTAAATACCAGTTTCTCGAGAAACTGGTATTTACAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011487.1-2413s1c1
Sequence:CCGGGCGAGACTACAAGGTTATCATCTCGAGATGATAACCTTGTAGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011487.1-1569s1c1
Sequence:CCGGCGTCCATTGACAAGAATGTTTCTCGAGAAACATTCTTGTCAATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011487
STAT4 MISSION shRNA Lentiviral Transduction Particles
signal transducer and activator of transcription 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011487.4-2151s21c1
Sequence:CCGGAGCAATATTGGACCTAATTAACTCGAGTTAATTAGGTCCAATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011487.4-717s21c1
Sequence:CCGGGCTATTGATTCACAATCTAAACTCGAGTTTAGATTGTGAATCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011487.4-2785s21c1
Sequence:CCGGCTTTACCATAGATCACAATTTCTCGAGAAATTGTGATCTATGGTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011487.4-1321s21c1
Sequence:CCGGCTACAGGAGCAATCTACTAAACTCGAGTTTAGTAGATTGCTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011487.4-2733s21c1
Sequence:CCGGACGGTGCAAACGGACACTTTACTCGAGTAAAGTGTCCGTTTGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011487.1-1077s1c1
Sequence:CCGGCGCTGCAAGAAATGCTTAATACTCGAGTATTAAGCATTTCTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011487.1-1568s1c1
Sequence:CCGGGCGTCCATTGACAAGAATGTTCTCGAGAACATTCTTGTCAATGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011487.1-2814s1c1
Sequence:CCGGCGGCTTTGTAAATACCAGTTTCTCGAGAAACTGGTATTTACAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011487.1-2413s1c1
Sequence:CCGGGCGAGACTACAAGGTTATCATCTCGAGATGATAACCTTGTAGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011487.1-1569s1c1
Sequence:CCGGCGTCCATTGACAAGAATGTTTCTCGAGAAACATTCTTGTCAATGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003151
STAT4 MISSION shRNA Bacterial Glycerol Stock
signal transducer and activator of transcription 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003151.2-2517s1c1
Sequence:CCGGCGCACCAAGAAAGGAAGCAAACTCGAGTTTGCTTCCTTTCTTGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003151.2-2180s1c1
Sequence:CCGGGCGAGACTACAAAGTTATTATCTCGAGATAATAACTTTGTAGTCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003151.2-1036s1c1
Sequence:CCGGGCTTTACACTATTGGCAGAAACTCGAGTTTCTGCCAATAGTGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003151.2-1776s1c1
Sequence:CCGGCGTGGTCTTAACTCAGATCAACTCGAGTTGATCTGAGTTAAGACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003151.2-1716s1c1
Sequence:CCGGCCTGCCACATTGAGTCAACTACTCGAGTAGTTGACTCAATGTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003151
STAT4 MISSION shRNA shRNA Plasmid DNA
signal transducer and activator of transcription 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003151.2-2517s1c1
Sequence:CCGGCGCACCAAGAAAGGAAGCAAACTCGAGTTTGCTTCCTTTCTTGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003151.2-2180s1c1
Sequence:CCGGGCGAGACTACAAAGTTATTATCTCGAGATAATAACTTTGTAGTCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003151.2-1036s1c1
Sequence:CCGGGCTTTACACTATTGGCAGAAACTCGAGTTTCTGCCAATAGTGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003151.2-1776s1c1
Sequence:CCGGCGTGGTCTTAACTCAGATCAACTCGAGTTGATCTGAGTTAAGACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003151.2-1716s1c1
Sequence:CCGGCCTGCCACATTGAGTCAACTACTCGAGTAGTTGACTCAATGTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003151
STAT4 MISSION shRNA Lentiviral Transduction Particles
signal transducer and activator of transcription 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020894    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003151.2-2517s1c1
Sequence:CCGGCGCACCAAGAAAGGAAGCAAACTCGAGTTTGCTTCCTTTCTTGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003151.2-2180s1c1
Sequence:CCGGGCGAGACTACAAAGTTATTATCTCGAGATAATAACTTTGTAGTCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003151.2-1036s1c1
Sequence:CCGGGCTTTACACTATTGGCAGAAACTCGAGTTTCTGCCAATAGTGTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003151.2-1776s1c1
Sequence:CCGGCGTGGTCTTAACTCAGATCAACTCGAGTTGATCTGAGTTAAGACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003151.2-1716s1c1
Sequence:CCGGCCTGCCACATTGAGTCAACTACTCGAGTAGTTGACTCAATGTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks