EMAIL THIS PAGE TO A FRIEND

STAT5A

signal transducer and activator of transcription 5A

Synonyms: MGF STAT5
UniProtKB ID: P42229
Gene ID:
Human(6776) Summary: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated by, and mediates the responses of many cell ligands, such as IL2, IL3, IL7 GM-CSF, erythropoietin, thrombopoietin, and different growth hormones. Activation of this protein in myeloma and lymphoma associated with a TEL/JAK2 gene fusion is independent of cell stimulus and has been shown to be essential for the tumorigenesis. The mouse counterpart of this gene is found to induce the expression of BCL2L1/BCL-X(L), which suggests the antiapoptotic function of this gene in cells. [provided by RefSeq, Jul 2008]
Mouse(20850) signal transducer and activator of transcription 5A
Rat(24918) signal transducer and activator of transcription 5A
dog(490968) signal transducer and activator of transcription 5A
Horse(100052904) signal transducer and activator of transcription 5A
domestic cat(101090913) signal transducer and activator of transcription 5A
cow(282375) signal transducer and activator of transcription 5A
sheep(443419) signal transducer and activator of transcription 5A
naked mole-rat(101723770) signal transducer and activator of transcription 5A
domestic guinea pig(100716811) signal transducer and activator of transcription 5A
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300037 Anti-phospho-STAT5A (pSer780) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4504543 Anti-phospho-STAT5A (pSer780) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4300036 Anti-phospho-STAT5A (pTyr694) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4504544 Anti-phospho-STAT5A (pTyr694) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504213 Anti-phospho-STAT5A/B (pSer725/730) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300329 Anti-STAT5A (Ab-694) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4300330 Anti-STAT5A (Ab-780) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB1406488 Anti-STAT5A antibody produced in mouse purified immunoglobulin, buffered aqueous solution rat, mouse, human
immunofluorescence, western blot pricing
SAB2102318 Anti-STAT5A antibody produced in rabbit affinity isolated antibody canine, pig, rat, mouse, horse, sheep, human, guinea pig, bovine, rabbit, goat
western blot pricing
HPA027873 Anti-STAT5A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502878 Anti-STAT5A antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4502879 Anti-STAT5A antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
HPA042128 Anti-STAT5A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA049883 Anti-STAT5A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA051156 Anti-STAT5A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4502875 Anti-STAT5A, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
SAB4502876 Anti-STAT5A, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4502877 Anti-STAT5A, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB1404416 Monoclonal Anti-STAT5A, (N-terminal) antibody produced in mouse clone 1B12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003152 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003152 Rosetta Predictions human pricing
NM_017064 Rosetta Predictions rat pricing
NM_011488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086130 predicted 1967
2 SASI_Hs01_00086131 predicted 2866
3 SASI_Hs01_00086132 predicted 1950
4 SASI_Hs01_00086133 predicted 2887
5 SASI_Hs01_00086134 predicted 2625
6 SASI_Hs01_00086135 predicted 1995
7 SASI_Hs01_00086136 predicted 2573
8 SASI_Hs01_00086137 predicted 2485
9 SASI_Hs01_00086138 predicted 730
10 SASI_Hs01_00086139 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057534 predicted 1359
2 SASI_Rn01_00057536 predicted 2085
3 SASI_Rn01_00057537 predicted 2293
4 SASI_Rn01_00057538 predicted 2483
5 SASI_Rn01_00057539 predicted 1738
6 SASI_Rn01_00057540 predicted 1973
7 SASI_Rn01_00057541 predicted 2291
8 SASI_Rn01_00057542 predicted 2462
9 SASI_Rn01_00057543 predicted 1375
10 SASI_Rn02_00261267 predicted 2084
11 SASI_Rn01_00057535 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091675 predicted 2733
2 SASI_Mm01_00091676 predicted 1601
3 SASI_Mm01_00091677 predicted 2219
4 SASI_Mm01_00091678 predicted 2178
5 SASI_Mm01_00091679 predicted 2326
6 SASI_Mm01_00091680 predicted 2217
7 SASI_Mm01_00091681 predicted 413
8 SASI_Mm01_00091683 predicted 2323
9 SASI_Mm01_00091684 predicted 347
10 SASI_Mm02_00320777 predicted 1617
11 SASI_Mm01_00091682 predicted 2659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003152
VALIDATED
STAT5A MISSION shRNA Bacterial Glycerol Stock
signal transducer and activator of transcription 5A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003152.2-3697s1c1
Sequence:CCGGGCTCTGAATTAGTCCTTGCTTCTCGAGAAGCAAGGACTAATTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003152.2-2558s1c1
Sequence:CCGGCCTGTGGAACCTGAAACCATTCTCGAGAATGGTTTCAGGTTCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_003152.2-2868s1c1
Sequence:CCGGGACCATGTACTCGATCAGGATCTCGAGATCCTGATCGAGTACATGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003152.2-1953s1c1
Sequence:CCGGGAGAAGTTCACAGTCCTGTTTCTCGAGAAACAGGACTGTGAACTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003152.2-2479s21c1
Sequence:CCGGGGACCTTCTTGTTGCGCTTTACTCGAGTAAAGCGCAACAAGAAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003152.2-3761s21c1
Sequence:CCGGCCCACGTTTCCCGGGATATATCTCGAGATATATCCCGGGAAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003152.2-2573s21c1
Sequence:CCGGACCATTCACCACGCGGGATTTCTCGAGAAATCCCGCGTGGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003152.2-967s21c1
Sequence:CCGGTCCGGCACATTCTGTACAATGCTCGAGCATTGTACAGAATGTGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003152.2-772s21c1
Sequence:CCGGATGCCATTGACTTGGACAATCCTCGAGGATTGTCCAAGTCAATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003152
VALIDATED
STAT5A MISSION shRNA shRNA Plasmid DNA
signal transducer and activator of transcription 5A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003152.2-3697s1c1
Sequence:CCGGGCTCTGAATTAGTCCTTGCTTCTCGAGAAGCAAGGACTAATTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003152.2-2558s1c1
Sequence:CCGGCCTGTGGAACCTGAAACCATTCTCGAGAATGGTTTCAGGTTCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_003152.2-2868s1c1
Sequence:CCGGGACCATGTACTCGATCAGGATCTCGAGATCCTGATCGAGTACATGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003152.2-1953s1c1
Sequence:CCGGGAGAAGTTCACAGTCCTGTTTCTCGAGAAACAGGACTGTGAACTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003152.2-2479s21c1
Sequence:CCGGGGACCTTCTTGTTGCGCTTTACTCGAGTAAAGCGCAACAAGAAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003152.2-3761s21c1
Sequence:CCGGCCCACGTTTCCCGGGATATATCTCGAGATATATCCCGGGAAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003152.2-2573s21c1
Sequence:CCGGACCATTCACCACGCGGGATTTCTCGAGAAATCCCGCGTGGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003152.2-967s21c1
Sequence:CCGGTCCGGCACATTCTGTACAATGCTCGAGCATTGTACAGAATGTGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003152.2-772s21c1
Sequence:CCGGATGCCATTGACTTGGACAATCCTCGAGGATTGTCCAAGTCAATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003152
VALIDATED
STAT5A MISSION shRNA Lentiviral Transduction Particles
signal transducer and activator of transcription 5A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003152.2-3697s1c1
Sequence:CCGGGCTCTGAATTAGTCCTTGCTTCTCGAGAAGCAAGGACTAATTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003152.2-2558s1c1
Sequence:CCGGCCTGTGGAACCTGAAACCATTCTCGAGAATGGTTTCAGGTTCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_003152.2-2868s1c1
Sequence:CCGGGACCATGTACTCGATCAGGATCTCGAGATCCTGATCGAGTACATGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003152.2-1953s1c1
Sequence:CCGGGAGAAGTTCACAGTCCTGTTTCTCGAGAAACAGGACTGTGAACTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003152.2-2479s21c1
Sequence:CCGGGGACCTTCTTGTTGCGCTTTACTCGAGTAAAGCGCAACAAGAAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232136    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003152.2-3761s21c1
Sequence:CCGGCCCACGTTTCCCGGGATATATCTCGAGATATATCCCGGGAAACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003152.2-2573s21c1
Sequence:CCGGACCATTCACCACGCGGGATTTCTCGAGAAATCCCGCGTGGTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003152.2-967s21c1
Sequence:CCGGTCCGGCACATTCTGTACAATGCTCGAGCATTGTACAGAATGTGCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003152.2-772s21c1
Sequence:CCGGATGCCATTGACTTGGACAATCCTCGAGGATTGTCCAAGTCAATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011488
STAT5A MISSION shRNA Bacterial Glycerol Stock
signal transducer and activator of transcription 5A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011488.2-338s1c1
Sequence:CCGGCGCCAGATGCAAGTGTTGTATCTCGAGATACAACACTTGCATCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011488.2-347s1c1
Sequence:CCGGCAAGTGTTGTATGGGCAGCATCTCGAGATGCTGCCCATACAACACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011488.2-2877s1c1
Sequence:CCGGGAACCTATCATTGCTGACAAACTCGAGTTTGTCAGCAATGATAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011488.2-2209s1c1
Sequence:CCGGCCTCTGGAATCTGAAGCCATTCTCGAGAATGGCTTCAGATTCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011488.2-2330s1c1
Sequence:CCGGGCCAAGTATTACACTCCTGTACTCGAGTACAGGAGTGTAATACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011488.2-3200s21c1
Sequence:CCGGGACGTGAGATTCAAGTCTAACCTCGAGGTTAGACTTGAATCTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011488.2-2320s21c1
Sequence:CCGGCGAGGTCTTTGCCAAGTATTACTCGAGTAATACTTGGCAAAGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011488.2-2526s21c1
Sequence:CCGGTTGACCAAGATGGCGAGTTTGCTCGAGCAAACTCGCCATCTTGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011488.2-2397s21c1
Sequence:CCGGTGGTCCCTGAGTTCGTCAATGCTCGAGCATTGACGAACTCAGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011488.2-2224s21c1
Sequence:CCGGGCCATTCACGACGCGAGATTTCTCGAGAAATCTCGCGTCGTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011488
STAT5A MISSION shRNA shRNA Plasmid DNA
signal transducer and activator of transcription 5A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011488.2-338s1c1
Sequence:CCGGCGCCAGATGCAAGTGTTGTATCTCGAGATACAACACTTGCATCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011488.2-347s1c1
Sequence:CCGGCAAGTGTTGTATGGGCAGCATCTCGAGATGCTGCCCATACAACACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011488.2-2877s1c1
Sequence:CCGGGAACCTATCATTGCTGACAAACTCGAGTTTGTCAGCAATGATAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011488.2-2209s1c1
Sequence:CCGGCCTCTGGAATCTGAAGCCATTCTCGAGAATGGCTTCAGATTCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011488.2-2330s1c1
Sequence:CCGGGCCAAGTATTACACTCCTGTACTCGAGTACAGGAGTGTAATACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011488.2-3200s21c1
Sequence:CCGGGACGTGAGATTCAAGTCTAACCTCGAGGTTAGACTTGAATCTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011488.2-2320s21c1
Sequence:CCGGCGAGGTCTTTGCCAAGTATTACTCGAGTAATACTTGGCAAAGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011488.2-2526s21c1
Sequence:CCGGTTGACCAAGATGGCGAGTTTGCTCGAGCAAACTCGCCATCTTGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011488.2-2397s21c1
Sequence:CCGGTGGTCCCTGAGTTCGTCAATGCTCGAGCATTGACGAACTCAGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011488.2-2224s21c1
Sequence:CCGGGCCATTCACGACGCGAGATTTCTCGAGAAATCTCGCGTCGTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011488
STAT5A MISSION shRNA Lentiviral Transduction Particles
signal transducer and activator of transcription 5A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011488.2-338s1c1
Sequence:CCGGCGCCAGATGCAAGTGTTGTATCTCGAGATACAACACTTGCATCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011488.2-347s1c1
Sequence:CCGGCAAGTGTTGTATGGGCAGCATCTCGAGATGCTGCCCATACAACACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011488.2-2877s1c1
Sequence:CCGGGAACCTATCATTGCTGACAAACTCGAGTTTGTCAGCAATGATAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011488.2-2209s1c1
Sequence:CCGGCCTCTGGAATCTGAAGCCATTCTCGAGAATGGCTTCAGATTCCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011488.2-2330s1c1
Sequence:CCGGGCCAAGTATTACACTCCTGTACTCGAGTACAGGAGTGTAATACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011488.2-3200s21c1
Sequence:CCGGGACGTGAGATTCAAGTCTAACCTCGAGGTTAGACTTGAATCTCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011488.2-2320s21c1
Sequence:CCGGCGAGGTCTTTGCCAAGTATTACTCGAGTAATACTTGGCAAAGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011488.2-2526s21c1
Sequence:CCGGTTGACCAAGATGGCGAGTTTGCTCGAGCAAACTCGCCATCTTGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011488.2-2397s21c1
Sequence:CCGGTGGTCCCTGAGTTCGTCAATGCTCGAGCATTGACGAACTCAGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011488.2-2224s21c1
Sequence:CCGGGCCATTCACGACGCGAGATTTCTCGAGAAATCTCGCGTCGTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks