EMAIL THIS PAGE TO A FRIEND

STAT5B

signal transducer and activator of transcription 5B

Synonyms: STAT5
UniProtKB ID: P51692, Q8WWS8
Gene ID:
Human(6777) Summary: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein mediates the signal transduction triggered by various cell ligands, such as IL2, IL4, CSF1, and different growth hormones. It has been shown to be involved in diverse biological processes, such as TCR signaling, apoptosis, adult mammary gland development, and sexual dimorphism of liver gene expression. This gene was found to fuse to retinoic acid receptor-alpha (RARA) gene in a small subset of acute promyelocytic leukemias (APLL). The dysregulation of the signaling pathways mediated by this protein may be the cause of the APLL. [provided by RefSeq, Jul 2008]
Mouse(20851) signal transducer and activator of transcription 5B
Rat(25126) signal transducer and activator of transcription 5B
domestic guinea pig(100716532) signal transducer and activator of transcription 5B
naked mole-rat(101722721) signal transducer and activator of transcription 5B
cow(282376) signal transducer and activator of transcription 5B
sheep(101122961) signal transducer and activator of transcription 5B
chicken(395556) signal transducer and activator of transcription 5B
domestic cat(101090663) signal transducer and activator of transcription 5B
dog(490969) signal transducer and activator of transcription 5B
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504544 Anti-phospho-STAT5A (pTyr694) antibody produced in rabbit affinity isolated antibody human, rat, mouse
pricing
SAB4504213 Anti-phospho-STAT5A/B (pSer725/730) antibody produced in rabbit affinity isolated antibody human, mouse, rat
pricing
SAB4503837 Anti-phospho-STAT5B (pSer731) antibody produced in rabbit affinity isolated antibody rat, mouse, human
pricing
SAB2102319 Anti-STAT5B (ab1) antibody produced in rabbit affinity isolated antibody pig, human, rabbit, rat, bovine, canine, horse, mouse
western blot pricing
SAB2102320 Anti-STAT5B (ab2) antibody produced in rabbit affinity isolated antibody , human, guinea pig, sheep, zebrafish, goat, bovine, mouse, canine, pig, rat, horse, rabbit
western blot pricing
SAB1412214 ANTI-STAT5B antibody produced in mouse clone 2D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412218 ANTI-STAT5B antibody produced in mouse clone 1C2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412225 ANTI-STAT5B antibody produced in mouse clone 1F5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV39001 Anti-STAT5B antibody produced in rabbit affinity isolated antibody guinea pig, horse, pig, human, bovine, rat, rabbit, zebrafish, mouse
western blot pricing
AV37146 Anti-STAT5B antibody produced in rabbit IgG fraction of antiserum guinea pig, sheep, canine, zebrafish, horse, rabbit, human, bovine, pig, rat, mouse, goat
western blot pricing
S6183 Anti-STAT5B antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunoprecipitation, western blot pricing
SAB2105315 Anti-STAT5B, (C-terminal) antibody produced in rabbit affinity isolated antibody mouse, rabbit, horse, guinea pig
western blot pricing
SAB4502880 Anti-STAT5B, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
pricing
WH0006777M1 Monoclonal Anti-STAT5B antibody produced in mouse clone 1A1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB5300364 Monoclonal Anti-STAT5B antibody produced in mouse clone 5B3, ascites fluid human
ELISA, western blot pricing
SAB1404417 Monoclonal Anti-STAT5B, (C-terminal) antibody produced in mouse clone 5D6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011489 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011489 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011489 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012448 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012448 Rosetta Predictions human pricing
NM_022380 Rosetta Predictions rat pricing
NM_001113563 Rosetta Predictions mouse pricing
NM_011489 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015667 predicted 2196
2 SASI_Hs01_00015668 predicted 1891
3 SASI_Hs01_00015669 predicted 1490
4 SASI_Hs01_00015670 predicted 494
5 SASI_Hs01_00015671 predicted 493
6 SASI_Hs01_00015673 predicted 1863
7 SASI_Hs01_00015674 predicted 1502
8 SASI_Hs01_00015676 predicted 227
9 SASI_Hs02_00344351 predicted 2058
10 SASI_Hs02_00344352 predicted 1912
11 SASI_Hs01_00015672 predicted 2053
12 SASI_Hs01_00015675 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038349 predicted 2003
2 SASI_Rn01_00038350 predicted 232
3 SASI_Rn01_00038351 predicted 424
4 SASI_Rn01_00038352 predicted 1790
5 SASI_Rn01_00038353 predicted 2136
6 SASI_Rn01_00038354 predicted 1442
7 SASI_Rn01_00038355 predicted 1802
8 SASI_Rn01_00038356 predicted 2336
9 SASI_Rn01_00038357 predicted 222
10 SASI_Rn01_00038358 predicted 1784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113563 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308219 predicted 1874
2 SASI_Mm02_00308220 predicted 1887
3 SASI_Mm02_00308221 predicted 1547
4 SASI_Mm02_00308222 predicted 2218
5 SASI_Mm02_00308223 predicted 1520
6 SASI_Mm02_00308224 predicted 1895
7 SASI_Mm02_00308225 predicted 1872
8 SASI_Mm02_00308226 predicted 1506
9 SASI_Mm02_00308227 predicted 2576
10 SASI_Mm02_00308228 predicted 2320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057410 predicted 2204
2 SASI_Mm01_00057411 predicted 2218
3 SASI_Mm01_00057413 predicted 1878
4 SASI_Mm01_00057414 predicted 2552
5 SASI_Mm01_00057415 predicted 1854
6 SASI_Mm01_00057416 predicted 2227
7 SASI_Mm01_00057417 predicted 2202
8 SASI_Mm01_00057419 predicted 1842
9 SASI_Mm02_00320778 predicted 2900
10 SASI_Mm02_00320779 predicted 2654
11 SASI_Mm01_00057412 predicted 612
12 SASI_Mm01_00057418 predicted 538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011489
VALIDATED
STAT5B MISSION shRNA Bacterial Glycerol Stock
signal transducer and activator of transcription 5B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011489.3-3219s21c1
Sequence:CCGGGACCCTTGACACGTGACTATCCTCGAGGATAGTCACGTGTCAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011489.3-2212s21c1
Sequence:CCGGGAATTTGCCAGGACGGAATTACTCGAGTAATTCCGTCCTGGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011489.3-647s21c1
Sequence:CCGGAGCCAAGCCTGGGACTCAATACTCGAGTATTGAGTCCCAGGCTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011489.3-1842s21c1
Sequence:CCGGAGAAGTTCACGATCCTGTTTGCTCGAGCAAACAGGATCGTGAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011489.3-608s21c1
Sequence:CCGGCCCATCGAGGTGCGACATTATCTCGAGATAATGTCGCACCTCGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011489.2-2500s1c1
Sequence:CCGGCGGCCAAAGGATGAAGTATATCTCGAGATATACTTCATCCTTTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011489.2-624s1c1
Sequence:CCGGTCTTGATAATCCACAGGAGAACTCGAGTTCTCCTGTGGATTATCAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011489.2-2383s1c1
Sequence:CCGGGACTCTCAGGAGAGAATGTTTCTCGAGAAACATTCTCTCCTGAGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011489.2-1779s1c1
Sequence:CCGGAGGGTCAGTAACGGAAGAGAACTCGAGTTCTCTTCCGTTACTGACCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011489.2-2916s1c1
Sequence:CCGGCGCTTCTCTTTGGAAACAATACTCGAGTATTGTTTCCAAAGAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011489
VALIDATED
STAT5B MISSION shRNA shRNA Plasmid DNA
signal transducer and activator of transcription 5B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011489.3-3219s21c1
Sequence:CCGGGACCCTTGACACGTGACTATCCTCGAGGATAGTCACGTGTCAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011489.3-2212s21c1
Sequence:CCGGGAATTTGCCAGGACGGAATTACTCGAGTAATTCCGTCCTGGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011489.3-647s21c1
Sequence:CCGGAGCCAAGCCTGGGACTCAATACTCGAGTATTGAGTCCCAGGCTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011489.3-1842s21c1
Sequence:CCGGAGAAGTTCACGATCCTGTTTGCTCGAGCAAACAGGATCGTGAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011489.3-608s21c1
Sequence:CCGGCCCATCGAGGTGCGACATTATCTCGAGATAATGTCGCACCTCGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011489.2-2500s1c1
Sequence:CCGGCGGCCAAAGGATGAAGTATATCTCGAGATATACTTCATCCTTTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011489.2-624s1c1
Sequence:CCGGTCTTGATAATCCACAGGAGAACTCGAGTTCTCCTGTGGATTATCAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011489.2-2383s1c1
Sequence:CCGGGACTCTCAGGAGAGAATGTTTCTCGAGAAACATTCTCTCCTGAGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011489.2-1779s1c1
Sequence:CCGGAGGGTCAGTAACGGAAGAGAACTCGAGTTCTCTTCCGTTACTGACCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011489.2-2916s1c1
Sequence:CCGGCGCTTCTCTTTGGAAACAATACTCGAGTATTGTTTCCAAAGAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011489
VALIDATED
STAT5B MISSION shRNA Lentiviral Transduction Particles
signal transducer and activator of transcription 5B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011489.3-3219s21c1
Sequence:CCGGGACCCTTGACACGTGACTATCCTCGAGGATAGTCACGTGTCAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011489.3-2212s21c1
Sequence:CCGGGAATTTGCCAGGACGGAATTACTCGAGTAATTCCGTCCTGGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011489.3-647s21c1
Sequence:CCGGAGCCAAGCCTGGGACTCAATACTCGAGTATTGAGTCCCAGGCTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011489.3-1842s21c1
Sequence:CCGGAGAAGTTCACGATCCTGTTTGCTCGAGCAAACAGGATCGTGAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011489.3-608s21c1
Sequence:CCGGCCCATCGAGGTGCGACATTATCTCGAGATAATGTCGCACCTCGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011489.2-2500s1c1
Sequence:CCGGCGGCCAAAGGATGAAGTATATCTCGAGATATACTTCATCCTTTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011489.2-624s1c1
Sequence:CCGGTCTTGATAATCCACAGGAGAACTCGAGTTCTCCTGTGGATTATCAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011489.2-2383s1c1
Sequence:CCGGGACTCTCAGGAGAGAATGTTTCTCGAGAAACATTCTCTCCTGAGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011489.2-1779s1c1
Sequence:CCGGAGGGTCAGTAACGGAAGAGAACTCGAGTTCTCTTCCGTTACTGACCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011489.2-2916s1c1
Sequence:CCGGCGCTTCTCTTTGGAAACAATACTCGAGTATTGTTTCCAAAGAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012448
VALIDATED
STAT5B MISSION shRNA Bacterial Glycerol Stock
signal transducer and activator of transcription 5B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_012448.3-4933s21c1
Sequence:CCGGGTGTCAAGGCAGATTAGTTATCTCGAGATAACTAATCTGCCTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_012448.3-1423s21c1
Sequence:CCGGTATGTCCCTGAAACGAATTAACTCGAGTTAATTCGTTTCAGGGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012448.3-486s21c1
Sequence:CCGGTCCGCTGCATCCGCCATATATCTCGAGATATATGGCGGATGCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012448.3-249s21c1
Sequence:CCGGCCATTGAGGTGCGGCATTATTCTCGAGAATAATGCCGCACCTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012448.3-215s21c1
Sequence:CCGGCATCAGATGCAAGCGTTATATCTCGAGATATAACGCTTGCATCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012448.3-497s1c1
Sequence:CCGGCGCCATATATTGTACAATGAACTCGAGTTCATTGTACAATATATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_012448.3-1985s1c1
Sequence:CCGGCTACTCATTAACAAGCCAGATCTCGAGATCTGGCTTGTTAATGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_012448.3-211s1c1
Sequence:CCGGCCTTCATCAGATGCAAGCGTTCTCGAGAACGCTTGCATCTGATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012448
VALIDATED
STAT5B MISSION shRNA shRNA Plasmid DNA
signal transducer and activator of transcription 5B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_012448.3-4933s21c1
Sequence:CCGGGTGTCAAGGCAGATTAGTTATCTCGAGATAACTAATCTGCCTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_012448.3-1423s21c1
Sequence:CCGGTATGTCCCTGAAACGAATTAACTCGAGTTAATTCGTTTCAGGGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012448.3-486s21c1
Sequence:CCGGTCCGCTGCATCCGCCATATATCTCGAGATATATGGCGGATGCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012448.3-249s21c1
Sequence:CCGGCCATTGAGGTGCGGCATTATTCTCGAGAATAATGCCGCACCTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012448.3-215s21c1
Sequence:CCGGCATCAGATGCAAGCGTTATATCTCGAGATATAACGCTTGCATCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012448.3-497s1c1
Sequence:CCGGCGCCATATATTGTACAATGAACTCGAGTTCATTGTACAATATATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_012448.3-1985s1c1
Sequence:CCGGCTACTCATTAACAAGCCAGATCTCGAGATCTGGCTTGTTAATGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_012448.3-211s1c1
Sequence:CCGGCCTTCATCAGATGCAAGCGTTCTCGAGAACGCTTGCATCTGATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012448
VALIDATED
STAT5B MISSION shRNA Lentiviral Transduction Particles
signal transducer and activator of transcription 5B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_012448.3-4933s21c1
Sequence:CCGGGTGTCAAGGCAGATTAGTTATCTCGAGATAACTAATCTGCCTTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_012448.3-1423s21c1
Sequence:CCGGTATGTCCCTGAAACGAATTAACTCGAGTTAATTCGTTTCAGGGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012448.3-486s21c1
Sequence:CCGGTCCGCTGCATCCGCCATATATCTCGAGATATATGGCGGATGCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012448.3-249s21c1
Sequence:CCGGCCATTGAGGTGCGGCATTATTCTCGAGAATAATGCCGCACCTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012448.3-215s21c1
Sequence:CCGGCATCAGATGCAAGCGTTATATCTCGAGATATAACGCTTGCATCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012448.3-497s1c1
Sequence:CCGGCGCCATATATTGTACAATGAACTCGAGTTCATTGTACAATATATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_012448.3-1985s1c1
Sequence:CCGGCTACTCATTAACAAGCCAGATCTCGAGATCTGGCTTGTTAATGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_012448.3-211s1c1
Sequence:CCGGCCTTCATCAGATGCAAGCGTTCTCGAGAACGCTTGCATCTGATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks