EMAIL THIS PAGE TO A FRIEND

STAT6

signal transducer and activator of transcription 6, interleukin-4 induced

Synonyms: D12S1644 IL-4-STAT STAT6B STAT6C
UniProtKB ID: P42226, A8K316, B7ZA27, F5GXI9, Q5FBW5, Q71UP4
Gene ID:
Human(6778) Summary: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein plays a central role in exerting IL4 mediated biological responses. It is found to induce the expression of BCL2L1/BCL-X(L), which is responsible for the anti-apoptotic activity of IL4. Knockout studies in mice suggested the roles of this gene in differentiation of T helper 2 (Th2) cells, expression of cell surface markers, and class switch of immunoglobulins. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Mouse(20852) signal transducer and activator of transcription 6
Rat(362896) signal transducer and activator of transcription 6, interleukin-4 induced
Zebrafish(337413) signal transducer and activator of transcription 6, interleukin-4 induced
Horse(100050053) signal transducer and activator of transcription 6, interleukin-4 induced
domestic cat(101089873) signal transducer and activator of transcription 6, interleukin-4 induced
dog(100142679) signal transducer and activator of transcription 6, interleukin-4 induced
chicken(100859196) signal transducer and activator of transcription 6, interleukin-4 induced
cow(353105) signal transducer and activator of transcription 6, interleukin-4 induced
sheep(101102134) signal transducer and activator of transcription 6, interleukin-4 induced
naked mole-rat(101725744) signal transducer and activator of transcription 6, interleukin-4 induced
Domestic Rabbit(100344264) signal transducer and activator of transcription 6, interleukin-4 induced
domestic guinea pig(100726686) signal transducer and activator of transcription 6, interleukin-4 induced
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300039 Anti-phospho-STAT6 (pThr645) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4504545 Anti-phospho-STAT6 (pThr645) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4300038 Anti-phospho-STAT6 (pTyr641) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
S5061 Anti-phospho-STAT6 (pTyr641) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human, mouse
western blot pricing
SAB4504546 Anti-phospho-STAT6 (pTyr641) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
S6433 Anti-STAT6 (787-804) antibody produced in rabbit whole antiserum mouse (weakly), human
western blot pricing
SAB4300331 Anti-STAT6 (Ab-641) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300332 Anti-STAT6 (Ab-645) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
AV31048 Anti-STAT6 (AB1) antibody produced in rabbit affinity isolated antibody rat, mouse, bovine, canine, human, rabbit, horse, guinea pig
western blot pricing
AV38257 Anti-STAT6 (AB2) antibody produced in rabbit affinity isolated antibody mouse, guinea pig, horse, canine, human, rat, pig, rabbit
western blot pricing
GW22760 Anti-STAT6 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1406489 Anti-STAT6 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA001861 Anti-STAT6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502882 Anti-STAT6 antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4502881 Anti-STAT6, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
WH0006778M1 Monoclonal Anti-STAT6 antibody produced in mouse clone 6C10, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404418 Monoclonal Anti-STAT6 antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300363 Monoclonal Anti-STAT6 antibody produced in mouse clone 7D3, ascites fluid monkey, rat, human, mouse
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003153 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009284 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009284 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009284 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003153 Rosetta Predictions human pricing
NM_001044250 Rosetta Predictions rat pricing
NM_009284 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228593 predicted 948
2 SASI_Hs01_00228594 predicted 1902
3 SASI_Hs01_00228595 predicted 2832
4 SASI_Hs01_00228596 predicted 1062
5 SASI_Hs01_00228597 predicted 1873
6 SASI_Hs01_00228598 predicted 2257
7 SASI_Hs01_00228599 predicted 2264
8 SASI_Hs01_00228600 predicted 1142
9 SASI_Hs01_00228601 predicted 760
10 SASI_Hs02_00335156 predicted 1539
11 SASI_Hs01_00228592 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205227 predicted 1696
2 SASI_Rn02_00205228 predicted 1439
3 SASI_Rn02_00205229 predicted 2149
4 SASI_Rn02_00205230 predicted 213
5 SASI_Rn02_00205231 predicted 1743
6 SASI_Rn02_00205232 predicted 1511
7 SASI_Rn02_00205233 predicted 1352
8 SASI_Rn02_00205234 predicted 2136
9 SASI_Rn02_00205235 predicted 563
10 SASI_Rn02_00205236 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009284 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178715 predicted 1201
2 SASI_Mm02_00315785 predicted 1128
3 SASI_Mm01_00178716 predicted 1637
4 SASI_Mm01_00178718 predicted 1715
5 SASI_Mm01_00178720 predicted 497
6 SASI_Mm02_00315786 predicted 790
7 SASI_Mm01_00178722 predicted 1917
8 SASI_Mm01_00178723 predicted 2285
9 SASI_Mm02_00315787 predicted 1630
10 SASI_Mm01_00178724 predicted 2201
11 SASI_Mm01_00178717 predicted 2539
12 SASI_Mm01_00178719 predicted 2549
13 SASI_Mm01_00178721 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003153
VALIDATED
STAT6 MISSION shRNA Bacterial Glycerol Stock
signal transducer and activator of transcription 6, interleukin-4 induced
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003153.3-1768s1c1
Sequence:CCGGGTCGCAGTTCAACAAGGAGATCTCGAGATCTCCTTGTTGAACTGCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003153.3-3231s1c1
Sequence:CCGGGCAGGAACATACAGACACATTCTCGAGAATGTGTCTGTATGTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003153.3-762s1c1
Sequence:CCGGGCTTGATAGAAACTCCTGCTACTCGAGTAGCAGGAGTTTCTATCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003153.3-560s1c1
Sequence:CCGGGCCACTTTCAGACAAATACTTCTCGAGAAGTATTTGTCTGAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003153.3-2272s1c1
Sequence:CCGGGCCTTCTTATGACCTTGGAATCTCGAGATTCCAAGGTCATAAGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003153.3-3231s21c1
Sequence:CCGGGCAGGAACATACAGACACATTCTCGAGAATGTGTCTGTATGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_003153.3-318s21c1
Sequence:CCGGAGCGGCTCTATGTCGACTTTCCTCGAGGAAAGTCGACATAGAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003153.3-1768s21c1
Sequence:CCGGGTCGCAGTTCAACAAGGAGATCTCGAGATCTCCTTGTTGAACTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003153.3-560s21c1
Sequence:CCGGGCCACTTTCAGACAAATACTTCTCGAGAAGTATTTGTCTGAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003153
VALIDATED
STAT6 MISSION shRNA shRNA Plasmid DNA
signal transducer and activator of transcription 6, interleukin-4 induced
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003153.3-1768s1c1
Sequence:CCGGGTCGCAGTTCAACAAGGAGATCTCGAGATCTCCTTGTTGAACTGCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003153.3-3231s1c1
Sequence:CCGGGCAGGAACATACAGACACATTCTCGAGAATGTGTCTGTATGTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003153.3-762s1c1
Sequence:CCGGGCTTGATAGAAACTCCTGCTACTCGAGTAGCAGGAGTTTCTATCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003153.3-560s1c1
Sequence:CCGGGCCACTTTCAGACAAATACTTCTCGAGAAGTATTTGTCTGAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003153.3-2272s1c1
Sequence:CCGGGCCTTCTTATGACCTTGGAATCTCGAGATTCCAAGGTCATAAGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003153.3-3231s21c1
Sequence:CCGGGCAGGAACATACAGACACATTCTCGAGAATGTGTCTGTATGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_003153.3-318s21c1
Sequence:CCGGAGCGGCTCTATGTCGACTTTCCTCGAGGAAAGTCGACATAGAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003153.3-1768s21c1
Sequence:CCGGGTCGCAGTTCAACAAGGAGATCTCGAGATCTCCTTGTTGAACTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003153.3-560s21c1
Sequence:CCGGGCCACTTTCAGACAAATACTTCTCGAGAAGTATTTGTCTGAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003153
VALIDATED
STAT6 MISSION shRNA Lentiviral Transduction Particles
signal transducer and activator of transcription 6, interleukin-4 induced
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003153.3-1768s1c1
Sequence:CCGGGTCGCAGTTCAACAAGGAGATCTCGAGATCTCCTTGTTGAACTGCGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003153.3-3231s1c1
Sequence:CCGGGCAGGAACATACAGACACATTCTCGAGAATGTGTCTGTATGTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003153.3-762s1c1
Sequence:CCGGGCTTGATAGAAACTCCTGCTACTCGAGTAGCAGGAGTTTCTATCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003153.3-560s1c1
Sequence:CCGGGCCACTTTCAGACAAATACTTCTCGAGAAGTATTTGTCTGAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003153.3-2272s1c1
Sequence:CCGGGCCTTCTTATGACCTTGGAATCTCGAGATTCCAAGGTCATAAGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274209    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003153.3-3231s21c1
Sequence:CCGGGCAGGAACATACAGACACATTCTCGAGAATGTGTCTGTATGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_003153.3-318s21c1
Sequence:CCGGAGCGGCTCTATGTCGACTTTCCTCGAGGAAAGTCGACATAGAGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003153.3-1768s21c1
Sequence:CCGGGTCGCAGTTCAACAAGGAGATCTCGAGATCTCCTTGTTGAACTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003153.3-560s21c1
Sequence:CCGGGCCACTTTCAGACAAATACTTCTCGAGAAGTATTTGTCTGAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009284
VALIDATED
STAT6 MISSION shRNA Bacterial Glycerol Stock
signal transducer and activator of transcription 6, interleukin-4 induced
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009284.1-2875s1c1
Sequence:CCGGCGTCTCAACTGTTCCTTGGTTCTCGAGAACCAAGGAACAGTTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009284.1-2347s1c1
Sequence:CCGGCCACAGTCCATCCACTCATTTCTCGAGAAATGAGTGGATGGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009284.1-408s1c1
Sequence:CCGGCGGTTCAGATGCTTTCTGTTACTCGAGTAACAGAAAGCATCTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009284.1-1885s1c1
Sequence:CCGGCGGCTGATCATTGGCTTTATTCTCGAGAATAAAGCCAATGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009284.2-656s21c1
Sequence:GTACCGGAGCAGGAAGAACTCAAGTTTACTCGAGTAAACTTGAGTTCTTCCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009284.2-3564s21c1
Sequence:CCGGTCCTAGAGCCTGGGATATAAGCTCGAGCTTATATCCCAGGCTCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009284.2-2203s21c1
Sequence:CCGGGGTTATGTCTCTACTACTATCCTCGAGGATAGTAGTAGAGACATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009284.2-2154s21c1
Sequence:CCGGGGCTTTCCGGAGTCACTATAACTCGAGTTATAGTGACTCCGGAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009284.2-2103s21c1
Sequence:CCGGCCGGGATCTTGCTCAGTTAAACTCGAGTTTAACTGAGCAAGATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009284
VALIDATED
STAT6 MISSION shRNA shRNA Plasmid DNA
signal transducer and activator of transcription 6, interleukin-4 induced
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009284.1-2875s1c1
Sequence:CCGGCGTCTCAACTGTTCCTTGGTTCTCGAGAACCAAGGAACAGTTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009284.1-2347s1c1
Sequence:CCGGCCACAGTCCATCCACTCATTTCTCGAGAAATGAGTGGATGGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009284.1-408s1c1
Sequence:CCGGCGGTTCAGATGCTTTCTGTTACTCGAGTAACAGAAAGCATCTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009284.1-1885s1c1
Sequence:CCGGCGGCTGATCATTGGCTTTATTCTCGAGAATAAAGCCAATGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009284.2-656s21c1
Sequence:GTACCGGAGCAGGAAGAACTCAAGTTTACTCGAGTAAACTTGAGTTCTTCCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009284.2-3564s21c1
Sequence:CCGGTCCTAGAGCCTGGGATATAAGCTCGAGCTTATATCCCAGGCTCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009284.2-2203s21c1
Sequence:CCGGGGTTATGTCTCTACTACTATCCTCGAGGATAGTAGTAGAGACATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009284.2-2154s21c1
Sequence:CCGGGGCTTTCCGGAGTCACTATAACTCGAGTTATAGTGACTCCGGAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009284.2-2103s21c1
Sequence:CCGGCCGGGATCTTGCTCAGTTAAACTCGAGTTTAACTGAGCAAGATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009284
VALIDATED
STAT6 MISSION shRNA Lentiviral Transduction Particles
signal transducer and activator of transcription 6, interleukin-4 induced
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009284.1-2875s1c1
Sequence:CCGGCGTCTCAACTGTTCCTTGGTTCTCGAGAACCAAGGAACAGTTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009284.1-2347s1c1
Sequence:CCGGCCACAGTCCATCCACTCATTTCTCGAGAAATGAGTGGATGGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009284.1-408s1c1
Sequence:CCGGCGGTTCAGATGCTTTCTGTTACTCGAGTAACAGAAAGCATCTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009284.1-1885s1c1
Sequence:CCGGCGGCTGATCATTGGCTTTATTCTCGAGAATAAAGCCAATGATCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009284.2-656s21c1
Sequence:GTACCGGAGCAGGAAGAACTCAAGTTTACTCGAGTAAACTTGAGTTCTTCCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226181    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009284.2-3564s21c1
Sequence:CCGGTCCTAGAGCCTGGGATATAAGCTCGAGCTTATATCCCAGGCTCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009284.2-2203s21c1
Sequence:CCGGGGTTATGTCTCTACTACTATCCTCGAGGATAGTAGTAGAGACATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009284.2-2154s21c1
Sequence:CCGGGGCTTTCCGGAGTCACTATAACTCGAGTTATAGTGACTCCGGAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009284.2-2103s21c1
Sequence:CCGGCCGGGATCTTGCTCAGTTAAACTCGAGTTTAACTGAGCAAGATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks