EMAIL THIS PAGE TO A FRIEND

STATH

statherin

Synonyms: STR
UniProtKB ID: P02808, A6NKE9, B2R4F8
Gene ID:
dog(608839) statherin
cow(286765) statherin
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003154 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056561 MISSION® esiRNA esiRNA human STATH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009181 Rosetta Predictions human pricing
NM_003154 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054662 predicted 232
2 SASI_Hs01_00054663 predicted 220
3 SASI_Hs01_00054664 predicted 215
4 SASI_Hs01_00054665 predicted 322
5 SASI_Hs01_00054666 predicted 269
6 SASI_Hs01_00054667 predicted 308
7 SASI_Hs01_00054668 predicted 285
8 SASI_Hs01_00054669 predicted 214
9 SASI_Hs01_00054670 predicted 238
10 SASI_Hs01_00054671 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152349 predicted 328
2 SASI_Hs01_00152350 predicted 249
3 SASI_Hs01_00152351 predicted 245
4 SASI_Hs01_00152352 predicted 354
5 SASI_Hs01_00152353 predicted 304
6 SASI_Hs01_00152354 predicted 311
7 SASI_Hs01_00152355 predicted 205
8 SASI_Hs01_00152356 predicted 211
9 SASI_Hs01_00152357 predicted 208
10 SASI_Hs02_00335157 predicted 264
11 SASI_Hs01_00152358 predicted 254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003154
STATH MISSION shRNA Bacterial Glycerol Stock
statherin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003154.2-347s21c1
Sequence:CCGGTACGACTTCTACATCCATATTCTCGAGAATATGGATGTAGAAGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003154.2-156s21c1
Sequence:CCGGATGATTGGAGCTGATTCATCTCTCGAGAGATGAATCAGCTCCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003154.2-307s21c1
Sequence:CCGGAGTAACTGCAGGACATGATTACTCGAGTAATCATGTCCTGCAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003154.1-99s1c1
Sequence:CCGGCTTGGCTCTCATGGTTTCCATCTCGAGATGGAAACCATGAGAGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003154.1-164s1c1
Sequence:CCGGGAAGATTCGGTTATGGGTATGCTCGAGCATACCCATAACCGAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003154.1-197s1c1
Sequence:CCGGCAGTTCCAGAACAACCACTATCTCGAGATAGTGGTTGTTCTGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003154.1-127s1c1
Sequence:CCGGGCTGATTCATCTGAAGAGAAACTCGAGTTTCTCTTCAGATGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003154.1-231s1c1
Sequence:CCGGCCAACCACAATACCAACAATACTCGAGTATTGTTGGTATTGTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003154.1-220s1c1
Sequence:CCGGCCACAACCATACCAACCACAACTCGAGTTGTGGTTGGTATGGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003154.1-214s1c1
Sequence:CCGGCTATACCCACAACCATACCAACTCGAGTTGGTATGGTTGTGGGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003154
STATH MISSION shRNA shRNA Plasmid DNA
statherin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003154.2-347s21c1
Sequence:CCGGTACGACTTCTACATCCATATTCTCGAGAATATGGATGTAGAAGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003154.2-156s21c1
Sequence:CCGGATGATTGGAGCTGATTCATCTCTCGAGAGATGAATCAGCTCCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003154.2-307s21c1
Sequence:CCGGAGTAACTGCAGGACATGATTACTCGAGTAATCATGTCCTGCAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003154.1-99s1c1
Sequence:CCGGCTTGGCTCTCATGGTTTCCATCTCGAGATGGAAACCATGAGAGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003154.1-164s1c1
Sequence:CCGGGAAGATTCGGTTATGGGTATGCTCGAGCATACCCATAACCGAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003154.1-197s1c1
Sequence:CCGGCAGTTCCAGAACAACCACTATCTCGAGATAGTGGTTGTTCTGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003154.1-127s1c1
Sequence:CCGGGCTGATTCATCTGAAGAGAAACTCGAGTTTCTCTTCAGATGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003154.1-231s1c1
Sequence:CCGGCCAACCACAATACCAACAATACTCGAGTATTGTTGGTATTGTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003154.1-220s1c1
Sequence:CCGGCCACAACCATACCAACCACAACTCGAGTTGTGGTTGGTATGGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003154.1-214s1c1
Sequence:CCGGCTATACCCACAACCATACCAACTCGAGTTGGTATGGTTGTGGGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003154
STATH MISSION shRNA Lentiviral Transduction Particles
statherin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003154.2-347s21c1
Sequence:CCGGTACGACTTCTACATCCATATTCTCGAGAATATGGATGTAGAAGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003154.2-156s21c1
Sequence:CCGGATGATTGGAGCTGATTCATCTCTCGAGAGATGAATCAGCTCCAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003154.2-307s21c1
Sequence:CCGGAGTAACTGCAGGACATGATTACTCGAGTAATCATGTCCTGCAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003154.1-99s1c1
Sequence:CCGGCTTGGCTCTCATGGTTTCCATCTCGAGATGGAAACCATGAGAGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003154.1-164s1c1
Sequence:CCGGGAAGATTCGGTTATGGGTATGCTCGAGCATACCCATAACCGAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003154.1-197s1c1
Sequence:CCGGCAGTTCCAGAACAACCACTATCTCGAGATAGTGGTTGTTCTGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003154.1-127s1c1
Sequence:CCGGGCTGATTCATCTGAAGAGAAACTCGAGTTTCTCTTCAGATGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003154.1-231s1c1
Sequence:CCGGCCAACCACAATACCAACAATACTCGAGTATTGTTGGTATTGTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003154.1-220s1c1
Sequence:CCGGCCACAACCATACCAACCACAACTCGAGTTGTGGTTGGTATGGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003154.1-214s1c1
Sequence:CCGGCTATACCCACAACCATACCAACTCGAGTTGGTATGGTTGTGGGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks