EMAIL THIS PAGE TO A FRIEND

STAU1

staufen double-stranded RNA binding protein 1

Synonyms: STAU
Gene ID:
Human(6780) Summary: Staufen is a member of the family of double-stranded RNA (dsRNA)-binding proteins involved in the transport and/or localization of mRNAs to different subcellular compartments and/or organelles. These proteins are characterized by the presence of multiple dsRNA-binding domains which are required to bind RNAs having double-stranded secondary structures. The human homologue of staufen encoded by STAU, in addition contains a microtubule- binding domain similar to that of microtubule-associated protein 1B, and binds tubulin. The STAU gene product has been shown to be present in the cytoplasm in association with the rough endoplasmic reticulum (RER), implicating this protein in the transport of mRNA via the microtubule network to the RER, the site of translation. Five transcript variants resulting from alternative splicing of STAU gene and encoding three isoforms have been described. Three of these variants encode the same isoform, however, differ in their 5'UTR. [provided by RefSeq, Jul 2008]
Mouse(20853) staufen (RNA binding protein) homolog 1 (Drosophila)
Rat(84496) staufen double-stranded RNA binding protein 1
Zebrafish(334440) staufen, RNA binding protein, homolog 1 (Drosophila)
chicken(419213) staufen, RNA binding protein, homolog 1 (Drosophila)
domestic cat(101080626) staufen, RNA binding protein, homolog 1 (Drosophila)
Horse(100056924) staufen, RNA binding protein, homolog 1 (Drosophila)
dog(477258) staufen, RNA binding protein, homolog 1 (Drosophila)
cow(513944) staufen double-stranded RNA binding protein 1
sheep(101120429) staufen, RNA binding protein, homolog 1 (Drosophila)
domestic guinea pig(100733497) staufen double-stranded RNA binding protein 1
naked mole-rat(101704614) staufen double-stranded RNA binding protein 1
208 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108722 Anti-STAU1 affinity isolated antibody human, canine, guinea pig, pig, horse, bovine, rat
western blot pricing
SAB2102321 Anti-STAU1 (ab1) antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, horse, human
western blot pricing
SAB2102322 Anti-STAU1 (ab2) antibody produced in rabbit affinity isolated antibody horse, guinea pig, human
western blot pricing
SAB1406490 Anti-STAU1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412071 ANTI-STAU1 antibody produced in mouse clone 3C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412648 ANTI-STAU1 antibody produced in mouse clone 4D6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV40536 Anti-STAU1 antibody produced in rabbit affinity isolated antibody guinea pig, bovine, horse, human, rabbit, zebrafish, rat, mouse
western blot pricing
AV40537 Anti-STAU1 antibody produced in rabbit IgG fraction of antiserum rat, mouse, guinea pig, bovine, human, rabbit, horse
immunohistochemistry, western blot pricing
HPA049892 Anti-STAU1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB3500565 Anti-STAU1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0006780M1 Monoclonal Anti-STAU1 antibody produced in mouse clone 3D8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404419 Monoclonal Anti-STAU1, (C-terminal) antibody produced in mouse clone 1E7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004602 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004602 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004602 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011490 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011490 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011490 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037328 Rosetta Predictions human pricing
NM_004602 Rosetta Predictions human pricing
NM_017452 Rosetta Predictions human pricing
NM_017453 Rosetta Predictions human pricing
NM_017454 Rosetta Predictions human pricing
NM_001109907 Rosetta Predictions rat pricing
NM_053436 Rosetta Predictions rat pricing
NM_001109905 Rosetta Predictions mouse pricing
NM_001109906 Rosetta Predictions mouse pricing
NM_011490 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074944 predicted 1245
2 SASI_Hs01_00074945 predicted 1531
3 SASI_Hs01_00074946 predicted 1344
4 SASI_Hs01_00074947 predicted 1557
5 SASI_Hs01_00074948 predicted 1071
6 SASI_Hs01_00074949 predicted 1361
7 SASI_Hs01_00074950 predicted 1071
8 SASI_Hs02_00308264 predicted 1472
9 SASI_Hs01_00074952 predicted 1304
10 SASI_Hs01_00074953 predicted 1541
11 SASI_Hs01_00074951 predicted 1620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057083 predicted 1229
2 SASI_Hs01_00057084 predicted 1515
3 SASI_Hs01_00057085 predicted 1319
4 SASI_Hs01_00057086 predicted 1536
5 SASI_Hs01_00057087 predicted 1054
6 SASI_Hs01_00057088 predicted 1342
7 SASI_Hs01_00057089 predicted 1049
8 SASI_Hs02_00337980 predicted 1450
9 SASI_Hs01_00057091 predicted 1288
10 SASI_Hs01_00057092 predicted 1524
11 SASI_Hs01_00057090 predicted 1608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179728 predicted 1110
2 SASI_Hs01_00179729 predicted 1393
3 SASI_Hs01_00179730 predicted 1203
4 SASI_Hs01_00179731 predicted 1411
5 SASI_Hs01_00179732 predicted 930
6 SASI_Hs01_00179733 predicted 1220
7 SASI_Hs01_00179734 predicted 924
8 SASI_Hs02_00350068 predicted 1333
9 SASI_Hs01_00179736 predicted 1157
10 SASI_Hs01_00179737 predicted 1407
11 SASI_Hs01_00179735 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108836 predicted 1393
2 SASI_Hs01_00108837 predicted 1687
3 SASI_Hs01_00108838 predicted 1485
4 SASI_Hs01_00108839 predicted 1707
5 SASI_Hs01_00108840 predicted 1214
6 SASI_Hs01_00108841 predicted 1510
7 SASI_Hs01_00108842 predicted 1213
8 SASI_Hs02_00350069 predicted 1620
9 SASI_Hs01_00108844 predicted 1452
10 SASI_Hs01_00108845 predicted 1692
11 SASI_Hs01_00108843 predicted 1765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130991 predicted 1032
2 SASI_Hs01_00130992 predicted 1323
3 SASI_Hs01_00130993 predicted 1123
4 SASI_Hs01_00130994 predicted 1342
5 SASI_Hs01_00130995 predicted 856
6 SASI_Hs01_00130996 predicted 1142
7 SASI_Hs01_00130997 predicted 851
8 SASI_Hs02_00350070 predicted 1251
9 SASI_Hs01_00130999 predicted 1091
10 SASI_Hs01_00131000 predicted 1330
11 SASI_Hs01_00130998 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250852 predicted 1705
2 SASI_Rn02_00250853 predicted 1323
3 SASI_Rn02_00250854 predicted 1429
4 SASI_Rn02_00250855 predicted 1106
5 SASI_Rn02_00250856 predicted 1077
6 SASI_Rn02_00250857 predicted 1162
7 SASI_Rn02_00250858 predicted 1259
8 SASI_Rn02_00250859 predicted 1396
9 SASI_Rn02_00250860 predicted 1587
10 SASI_Rn02_00250861 predicted 1599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053436 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266005 predicted 1726
2 SASI_Rn01_00075432 predicted 1344
3 SASI_Rn01_00075433 predicted 1447
4 SASI_Rn01_00075434 predicted 1125
5 SASI_Rn01_00075437 predicted 1095
6 SASI_Rn01_00075439 predicted 1182
7 SASI_Rn02_00266006 predicted 1271
8 SASI_Rn02_00266007 predicted 1411
9 SASI_Rn02_00266008 predicted 1606
10 SASI_Rn02_00266009 predicted 1618
11 SASI_Rn01_00075430 predicted 372
12 SASI_Rn01_00075431 predicted 536
13 SASI_Rn01_00075435 predicted 548
14 SASI_Rn01_00075436 predicted 396
15 SASI_Rn01_00075438 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304394 predicted 1663
2 SASI_Mm02_00304395 predicted 404
3 SASI_Mm02_00304396 predicted 1389
4 SASI_Mm02_00304397 predicted 2021
5 SASI_Mm02_00304398 predicted 1658
6 SASI_Mm02_00304399 predicted 1573
7 SASI_Mm02_00304400 predicted 1224
8 SASI_Mm02_00304401 predicted 1251
9 SASI_Mm02_00304402 predicted 1459
10 SASI_Mm02_00304403 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304404 predicted 1676
2 SASI_Mm02_00304405 predicted 401
3 SASI_Mm02_00304406 predicted 1406
4 SASI_Mm02_00304407 predicted 2035
5 SASI_Mm02_00304408 predicted 1673
6 SASI_Mm02_00304409 predicted 1590
7 SASI_Mm02_00304410 predicted 1244
8 SASI_Mm02_00304411 predicted 1268
9 SASI_Mm02_00304412 predicted 1475
10 SASI_Mm02_00304413 predicted 1243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158401 predicted 1657
2 SASI_Mm01_00158404 predicted 403
3 SASI_Mm01_00158406 predicted 1384
4 SASI_Mm02_00320780 predicted 2015
5 SASI_Mm01_00158408 predicted 1651
6 SASI_Mm02_00320781 predicted 1570
7 SASI_Mm02_00320782 predicted 1213
8 SASI_Mm02_00320783 predicted 1247
9 SASI_Mm02_00320784 predicted 1450
10 SASI_Mm02_00320785 predicted 1219
11 SASI_Mm01_00158399 predicted 466
12 SASI_Mm01_00158400 predicted 647
13 SASI_Mm01_00158402 predicted 1058
14 SASI_Mm01_00158403 predicted 1011
15 SASI_Mm01_00158405 predicted 637
16 SASI_Mm01_00158407 predicted 1004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004602
STAU1 MISSION shRNA Bacterial Glycerol Stock
staufen double-stranded RNA binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166217    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004602.1-2526s1c1
Sequence:CCGGCCATCACCACTGCTTTCTCTTCTCGAGAAGAGAAAGCAGTGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164920    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004602.1-2795s1c1
Sequence:CCGGGCTGAAACAGTCCTGGACTTTCTCGAGAAAGTCCAGGACTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.1-1021s1c1
Sequence:CCGGCAGTTGAACGAGTAAAGCCTACTCGAGTAGGCTTTACTCGTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.1-813s1c1
Sequence:CCGGCAAGTGTTTGAGATTGCACTTCTCGAGAAGTGCAATCTCAAACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004602.1-2547s1c1
Sequence:CCGGCCAACAGTGATCTGTATTCTTCTCGAGAAGAATACAGATCACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.1-816s1c1
Sequence:CCGGGTGTTTGAGATTGCACTTAAACTCGAGTTTAAGTGCAATCTCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.1-1748s1c1
Sequence:CCGGCCAGGGATTCCAGGTTGAATACTCGAGTATTCAACCTGGAATCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.1-1016s1c1
Sequence:CCGGGCCTGCAGTTGAACGAGTAAACTCGAGTTTACTCGTTCAACTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.2-1350s1c1
Sequence:CCGGGAGGAGAAGACACCCATAAAGCTCGAGCTTTATGGGTGTCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.2-536s1c1
Sequence:CCGGTCGGATGCAGTCCACCTATAACTCGAGTTATAGGTGGACTGCATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004602
STAU1 MISSION shRNA shRNA Plasmid DNA
staufen double-stranded RNA binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166217    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004602.1-2526s1c1
Sequence:CCGGCCATCACCACTGCTTTCTCTTCTCGAGAAGAGAAAGCAGTGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164920    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004602.1-2795s1c1
Sequence:CCGGGCTGAAACAGTCCTGGACTTTCTCGAGAAAGTCCAGGACTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.1-1021s1c1
Sequence:CCGGCAGTTGAACGAGTAAAGCCTACTCGAGTAGGCTTTACTCGTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.1-813s1c1
Sequence:CCGGCAAGTGTTTGAGATTGCACTTCTCGAGAAGTGCAATCTCAAACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004602.1-2547s1c1
Sequence:CCGGCCAACAGTGATCTGTATTCTTCTCGAGAAGAATACAGATCACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.1-816s1c1
Sequence:CCGGGTGTTTGAGATTGCACTTAAACTCGAGTTTAAGTGCAATCTCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.1-1748s1c1
Sequence:CCGGCCAGGGATTCCAGGTTGAATACTCGAGTATTCAACCTGGAATCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.1-1016s1c1
Sequence:CCGGGCCTGCAGTTGAACGAGTAAACTCGAGTTTACTCGTTCAACTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.2-1350s1c1
Sequence:CCGGGAGGAGAAGACACCCATAAAGCTCGAGCTTTATGGGTGTCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.2-536s1c1
Sequence:CCGGTCGGATGCAGTCCACCTATAACTCGAGTTATAGGTGGACTGCATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004602
STAU1 MISSION shRNA Lentiviral Transduction Particles
staufen double-stranded RNA binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166217    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004602.1-2526s1c1
Sequence:CCGGCCATCACCACTGCTTTCTCTTCTCGAGAAGAGAAAGCAGTGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164920    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004602.1-2795s1c1
Sequence:CCGGGCTGAAACAGTCCTGGACTTTCTCGAGAAAGTCCAGGACTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.1-1021s1c1
Sequence:CCGGCAGTTGAACGAGTAAAGCCTACTCGAGTAGGCTTTACTCGTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.1-813s1c1
Sequence:CCGGCAAGTGTTTGAGATTGCACTTCTCGAGAAGTGCAATCTCAAACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004602.1-2547s1c1
Sequence:CCGGCCAACAGTGATCTGTATTCTTCTCGAGAAGAATACAGATCACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.1-816s1c1
Sequence:CCGGGTGTTTGAGATTGCACTTAAACTCGAGTTTAAGTGCAATCTCAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.1-1748s1c1
Sequence:CCGGCCAGGGATTCCAGGTTGAATACTCGAGTATTCAACCTGGAATCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.1-1016s1c1
Sequence:CCGGGCCTGCAGTTGAACGAGTAAACTCGAGTTTACTCGTTCAACTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.2-1350s1c1
Sequence:CCGGGAGGAGAAGACACCCATAAAGCTCGAGCTTTATGGGTGTCTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004602.2-536s1c1
Sequence:CCGGTCGGATGCAGTCCACCTATAACTCGAGTTATAGGTGGACTGCATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011490
VALIDATED
STAU1 MISSION shRNA Bacterial Glycerol Stock
staufen double-stranded RNA binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011490.1-689s1c1
Sequence:CCGGCCACCACACATGAAGAACTTTCTCGAGAAAGTTCTTCATGTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011490.1-1561s1c1
Sequence:CCGGCCAGGTTGAATACAAAGATTTCTCGAGAAATCTTTGTATTCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011490.1-556s1c1
Sequence:CCGGGCCAGAAAGGTTGGAGGTAAACTCGAGTTTACCTCCAACCTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011490.1-1551s1c1
Sequence:CCGGCCCAGGGATTCCAGGTTGAATCTCGAGATTCAACCTGGAATCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011490.1-2064s1c1
Sequence:CCGGGCTGGCTTCTTCAGATACTTTCTCGAGAAAGTATCTGAAGAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011490.3-1540s21c1
Sequence:CCGGCCAGGTTGAATACAAAGATTTCTCGAGAAATCTTTGTATTCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011490.3-879s21c1
Sequence:CCGGGCCAAGGGATGAATCCTATTACTCGAGTAATAGGATTCATCCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011490.3-579s21c1
Sequence:CCGGACCTCAATAAATCGGAAATAACTCGAGTTATTTCCGATTTATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011490.3-614s21c1
Sequence:CCGGATTGCGCTGAAGCGGAATTTGCTCGAGCAAATTCCGCTTCAGCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011490.3-2044s21c1
Sequence:CCGGGCTGGCTTCTTCAGATACTTTCTCGAGAAAGTATCTGAAGAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011490
VALIDATED
STAU1 MISSION shRNA shRNA Plasmid DNA
staufen double-stranded RNA binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011490.1-689s1c1
Sequence:CCGGCCACCACACATGAAGAACTTTCTCGAGAAAGTTCTTCATGTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011490.1-1561s1c1
Sequence:CCGGCCAGGTTGAATACAAAGATTTCTCGAGAAATCTTTGTATTCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011490.1-556s1c1
Sequence:CCGGGCCAGAAAGGTTGGAGGTAAACTCGAGTTTACCTCCAACCTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011490.1-1551s1c1
Sequence:CCGGCCCAGGGATTCCAGGTTGAATCTCGAGATTCAACCTGGAATCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011490.1-2064s1c1
Sequence:CCGGGCTGGCTTCTTCAGATACTTTCTCGAGAAAGTATCTGAAGAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011490.3-1540s21c1
Sequence:CCGGCCAGGTTGAATACAAAGATTTCTCGAGAAATCTTTGTATTCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011490.3-879s21c1
Sequence:CCGGGCCAAGGGATGAATCCTATTACTCGAGTAATAGGATTCATCCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011490.3-579s21c1
Sequence:CCGGACCTCAATAAATCGGAAATAACTCGAGTTATTTCCGATTTATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011490.3-614s21c1
Sequence:CCGGATTGCGCTGAAGCGGAATTTGCTCGAGCAAATTCCGCTTCAGCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011490.3-2044s21c1
Sequence:CCGGGCTGGCTTCTTCAGATACTTTCTCGAGAAAGTATCTGAAGAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011490
VALIDATED
STAU1 MISSION shRNA Lentiviral Transduction Particles
staufen double-stranded RNA binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011490.1-689s1c1
Sequence:CCGGCCACCACACATGAAGAACTTTCTCGAGAAAGTTCTTCATGTGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011490.1-1561s1c1
Sequence:CCGGCCAGGTTGAATACAAAGATTTCTCGAGAAATCTTTGTATTCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011490.1-556s1c1
Sequence:CCGGGCCAGAAAGGTTGGAGGTAAACTCGAGTTTACCTCCAACCTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011490.1-1551s1c1
Sequence:CCGGCCCAGGGATTCCAGGTTGAATCTCGAGATTCAACCTGGAATCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011490.1-2064s1c1
Sequence:CCGGGCTGGCTTCTTCAGATACTTTCTCGAGAAAGTATCTGAAGAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011490.3-1540s21c1
Sequence:CCGGCCAGGTTGAATACAAAGATTTCTCGAGAAATCTTTGTATTCAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011490.3-879s21c1
Sequence:CCGGGCCAAGGGATGAATCCTATTACTCGAGTAATAGGATTCATCCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011490.3-579s21c1
Sequence:CCGGACCTCAATAAATCGGAAATAACTCGAGTTATTTCCGATTTATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011490.3-614s21c1
Sequence:CCGGATTGCGCTGAAGCGGAATTTGCTCGAGCAAATTCCGCTTCAGCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011490.3-2044s21c1
Sequence:CCGGGCTGGCTTCTTCAGATACTTTCTCGAGAAAGTATCTGAAGAAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks