EMAIL THIS PAGE TO A FRIEND

STAU2

staufen double-stranded RNA binding protein 2

Synonyms: 39K2 39K3
Gene ID:
Human(27067) Summary: Staufen homolog 2 is a member of the family of double-stranded RNA (dsRNA)-binding proteins involved in the transport and/or localization of mRNAs to different subcellular compartments and/or organelles. These proteins are characterized by the presence of multiple dsRNA-binding domains which are required to bind RNAs having double-stranded secondary structures. Staufen homolog 2 shares 48.5% and 59.9% similarity with drosophila and human staufen, respectively. The exact function of Staufen homolog 2 is not known, but since it contains 3 copies of conserved dsRNA binding domain, it could be involved in double-stranded RNA binding events. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Mouse(29819) staufen (RNA binding protein) homolog 2 (Drosophila)
Rat(171500) staufen double-stranded RNA binding protein 2
naked mole-rat(101724389) staufen double-stranded RNA binding protein 2
Domestic Rabbit(100340385) staufen, RNA binding protein, homolog 2 (Drosophila)
domestic guinea pig(100712980) staufen double-stranded RNA binding protein 2
cow(100125233) staufen, RNA binding protein, homolog 2 (Drosophila)
sheep(101107105) staufen, RNA binding protein, homolog 2 (Drosophila)
Zebrafish(393899) staufen, RNA binding protein, homolog 2 (Drosophila)
chicken(420184) staufen, RNA binding protein, homolog 2 (Drosophila)
domestic cat(101099933) staufen, RNA binding protein, homolog 2 (Drosophila)
Horse(100051157) staufen, RNA binding protein, homolog 2 (Drosophila)
dog(477913) staufen, RNA binding protein, homolog 2 (Drosophila)
247 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014393 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014393 Rosetta Predictions human pricing
NM_001007149 Rosetta Predictions rat pricing
NM_001007150 Rosetta Predictions rat pricing
NM_134466 Rosetta Predictions rat pricing
XM_579171 Rosetta Predictions rat pricing
NM_001111272 Rosetta Predictions mouse pricing
NM_025303 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219722 predicted 551
2 SASI_Hs01_00219724 predicted 336
3 SASI_Hs01_00219725 predicted 751
4 SASI_Hs01_00219726 predicted 751
5 SASI_Hs01_00219727 predicted 738
6 SASI_Hs01_00219728 predicted 817
7 SASI_Hs01_00219729 predicted 512
8 SASI_Hs01_00219731 predicted 833
9 SASI_Hs02_00345575 predicted 331
10 SASI_Hs02_00345576 predicted 700
11 SASI_Hs01_00219723 predicted 659
12 SASI_Hs01_00219730 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198627 predicted 1293
2 SASI_Rn02_00198628 predicted 770
3 SASI_Rn02_00198629 predicted 823
4 SASI_Rn02_00198630 predicted 976
5 SASI_Rn02_00198631 predicted 613
6 SASI_Rn02_00198632 predicted 1712
7 SASI_Rn02_00198633 predicted 539
8 SASI_Rn02_00198634 predicted 1277
9 SASI_Rn02_00198635 predicted 1971
10 SASI_Rn02_00198636 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198637 predicted 1149
2 SASI_Rn02_00198638 predicted 1198
3 SASI_Rn02_00198639 predicted 1183
4 SASI_Rn02_00198640 predicted 255
5 SASI_Rn02_00198641 predicted 265
6 SASI_Rn01_00076014 predicted 260
7 SASI_Rn02_00198642 predicted 245
8 SASI_Rn02_00198643 predicted 1197
9 SASI_Rn02_00198644 predicted 259
10 SASI_Rn02_00198645 predicted 229
11 SASI_Rn01_00076005 predicted 505
12 SASI_Rn01_00076006 predicted 1019
13 SASI_Rn01_00076007 predicted 559
14 SASI_Rn01_00076008 predicted 701
15 SASI_Rn01_00076009 predicted 346
16 SASI_Rn01_00076010 predicted 520
17 SASI_Rn01_00076011 predicted 913
18 SASI_Rn01_00076012 predicted 355
19 SASI_Rn01_00076013 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268070 predicted 1242
2 SASI_Rn02_00268071 predicted 1292
3 SASI_Rn02_00268072 predicted 1275
4 SASI_Rn02_00268073 predicted 352
5 SASI_Rn02_00268074 predicted 356
6 SASI_Rn01_00097450 predicted 354
7 SASI_Rn02_00268075 predicted 342
8 SASI_Rn02_00268076 predicted 1291
9 SASI_Rn02_00268077 predicted 350
10 SASI_Rn02_00268078 predicted 327
11 SASI_Rn01_00097441 predicted 603
12 SASI_Rn01_00097442 predicted 1121
13 SASI_Rn01_00097443 predicted 657
14 SASI_Rn01_00097444 predicted 805
15 SASI_Rn01_00097445 predicted 448
16 SASI_Rn01_00097446 predicted 623
17 SASI_Rn01_00097447 predicted 1016
18 SASI_Rn01_00097448 predicted 451
19 SASI_Rn01_00097449 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579171 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175961 predicted 313
2 SASI_Rn01_00175962 predicted 299
3 SASI_Rn01_00175963 predicted 314
4 SASI_Rn01_00175964 predicted 207
5 SASI_Rn01_00175965 predicted 319
6 SASI_Rn01_00175966 predicted 348
7 SASI_Rn01_00175967 predicted 210
8 SASI_Rn01_00175968 predicted 322
9 SASI_Rn01_00175969 predicted 278
10 SASI_Rn01_00175970 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306582 predicted 878
2 SASI_Mm02_00306583 predicted 674
3 SASI_Mm02_00306584 predicted 520
4 SASI_Mm02_00306585 predicted 445
5 SASI_Mm02_00306586 predicted 1408
6 SASI_Mm02_00306587 predicted 1878
7 SASI_Mm02_00306588 predicted 734
8 SASI_Mm02_00306589 predicted 1888
9 SASI_Mm02_00306590 predicted 681
10 SASI_Mm02_00306591 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327932 predicted 1007
2 SASI_Mm02_00327933 predicted 806
3 SASI_Mm02_00327934 predicted 650
4 SASI_Mm02_00327935 predicted 571
5 SASI_Mm01_00172009 predicted 1541
6 SASI_Mm02_00327936 predicted 2006
7 SASI_Mm02_00327937 predicted 867
8 SASI_Mm02_00327938 predicted 2015
9 SASI_Mm02_00327939 predicted 815
10 SASI_Mm02_00327940 predicted 606
11 SASI_Mm01_00172004 predicted 781
12 SASI_Mm01_00172005 predicted 810
13 SASI_Mm01_00172006 predicted 209
14 SASI_Mm01_00172007 predicted 854
15 SASI_Mm01_00172008 predicted 274
16 SASI_Mm01_00172010 predicted 272
17 SASI_Mm01_00172011 predicted 858
18 SASI_Mm01_00172012 predicted 334
19 SASI_Mm01_00172013 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025303
VALIDATED
STAU2 MISSION shRNA Bacterial Glycerol Stock
staufen double-stranded RNA binding protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025303.3-1254s21c1
Sequence:CCGGGCAATGAAGTTGCGACTGGAACTCGAGTTCCAGTCGCAACTTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025303.3-1607s21c1
Sequence:CCGGGCCAGGGAACTCCTTATGAATCTCGAGATTCATAAGGAGTTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025303.3-1549s21c1
Sequence:CCGGCCAACCTTCAAGCTCTTTCTTCTCGAGAAGAAAGAGCTTGAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025303.3-1510s21c1
Sequence:CCGGTGGCACAACTCTAAGCTACTTCTCGAGAAGTAGCTTAGAGTTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025303.1-1509s1c1
Sequence:CCGGCCACTTATTCTTGTTCCCTTTCTCGAGAAAGGGAACAAGAATAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025303.1-556s1c1
Sequence:CCGGGCCAGGGAACTCCTTATGAATCTCGAGATTCATAAGGAGTTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025303.1-203s1c1
Sequence:CCGGGCAATGAAGTTGCGACTGGAACTCGAGTTCCAGTCGCAACTTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025303.1-459s1c1
Sequence:CCGGTGGCACAACTCTAAGCTACTTCTCGAGAAGTAGCTTAGAGTTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025303.1-498s1c1
Sequence:CCGGCCAACCTTCAAGCTCTTTCTTCTCGAGAAGAAAGAGCTTGAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025303
VALIDATED
STAU2 MISSION shRNA shRNA Plasmid DNA
staufen double-stranded RNA binding protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025303.3-1254s21c1
Sequence:CCGGGCAATGAAGTTGCGACTGGAACTCGAGTTCCAGTCGCAACTTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025303.3-1607s21c1
Sequence:CCGGGCCAGGGAACTCCTTATGAATCTCGAGATTCATAAGGAGTTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025303.3-1549s21c1
Sequence:CCGGCCAACCTTCAAGCTCTTTCTTCTCGAGAAGAAAGAGCTTGAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025303.3-1510s21c1
Sequence:CCGGTGGCACAACTCTAAGCTACTTCTCGAGAAGTAGCTTAGAGTTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025303.1-1509s1c1
Sequence:CCGGCCACTTATTCTTGTTCCCTTTCTCGAGAAAGGGAACAAGAATAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025303.1-556s1c1
Sequence:CCGGGCCAGGGAACTCCTTATGAATCTCGAGATTCATAAGGAGTTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025303.1-203s1c1
Sequence:CCGGGCAATGAAGTTGCGACTGGAACTCGAGTTCCAGTCGCAACTTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025303.1-459s1c1
Sequence:CCGGTGGCACAACTCTAAGCTACTTCTCGAGAAGTAGCTTAGAGTTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025303.1-498s1c1
Sequence:CCGGCCAACCTTCAAGCTCTTTCTTCTCGAGAAGAAAGAGCTTGAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025303
VALIDATED
STAU2 MISSION shRNA Lentiviral Transduction Particles
staufen double-stranded RNA binding protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025303.3-1254s21c1
Sequence:CCGGGCAATGAAGTTGCGACTGGAACTCGAGTTCCAGTCGCAACTTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025303.3-1607s21c1
Sequence:CCGGGCCAGGGAACTCCTTATGAATCTCGAGATTCATAAGGAGTTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025303.3-1549s21c1
Sequence:CCGGCCAACCTTCAAGCTCTTTCTTCTCGAGAAGAAAGAGCTTGAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025303.3-1510s21c1
Sequence:CCGGTGGCACAACTCTAAGCTACTTCTCGAGAAGTAGCTTAGAGTTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025303.1-1509s1c1
Sequence:CCGGCCACTTATTCTTGTTCCCTTTCTCGAGAAAGGGAACAAGAATAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025303.1-556s1c1
Sequence:CCGGGCCAGGGAACTCCTTATGAATCTCGAGATTCATAAGGAGTTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025303.1-203s1c1
Sequence:CCGGGCAATGAAGTTGCGACTGGAACTCGAGTTCCAGTCGCAACTTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025303.1-459s1c1
Sequence:CCGGTGGCACAACTCTAAGCTACTTCTCGAGAAGTAGCTTAGAGTTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025303.1-498s1c1
Sequence:CCGGCCAACCTTCAAGCTCTTTCTTCTCGAGAAGAAAGAGCTTGAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014393
VALIDATED
STAU2 MISSION shRNA Bacterial Glycerol Stock
staufen double-stranded RNA binding protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014393.1-1030s1c1
Sequence:CCGGATTAGCCGCCTGGCGCAAATTCTCGAGAATTTGCGCCAGGCGGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014393.1-1158s1c1
Sequence:CCGGTACAGGAACAGGACCTAATAACTCGAGTTATTAGGTCCTGTTCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014393.1-369s1c1
Sequence:CCGGCAATAACCCAGGCAGTATAACCTCGAGGTTATACTGCCTGGGTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014393.1-327s1c1
Sequence:CCGGGCTTCCCAAACCAGTTCAGAACTCGAGTTCTGAACTGGTTTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_014393.1-1498s1c1
Sequence:CCGGGCCAGGGAACTCCTTATGAATCTCGAGATTCATAAGGAGTTCCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014393.1-1679s1c1
Sequence:CCGGCCTCAGATTCTTCATCTGTATCTCGAGATACAGATGAAGAATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183772    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014393.1-3352s1c1
Sequence:CCGGCCCTCATTATTGCATTGCTAACTCGAGTTAGCAATGCAATAATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_014393.1-1440s1c1
Sequence:CCGGCCAACCTTCAAGCTCTTTCTTCTCGAGAAGAAAGAGCTTGAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_014393.1-1426s1c1
Sequence:CCGGCCCAAAGATATGAACCAACCTCTCGAGAGGTTGGTTCATATCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_014393.1-2828s1c1
Sequence:CCGGGCCAGGTAGTTGTTAGTGTTTCTCGAGAAACACTAACAACTACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014393
VALIDATED
STAU2 MISSION shRNA shRNA Plasmid DNA
staufen double-stranded RNA binding protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014393.1-1030s1c1
Sequence:CCGGATTAGCCGCCTGGCGCAAATTCTCGAGAATTTGCGCCAGGCGGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014393.1-1158s1c1
Sequence:CCGGTACAGGAACAGGACCTAATAACTCGAGTTATTAGGTCCTGTTCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014393.1-369s1c1
Sequence:CCGGCAATAACCCAGGCAGTATAACCTCGAGGTTATACTGCCTGGGTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014393.1-327s1c1
Sequence:CCGGGCTTCCCAAACCAGTTCAGAACTCGAGTTCTGAACTGGTTTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_014393.1-1498s1c1
Sequence:CCGGGCCAGGGAACTCCTTATGAATCTCGAGATTCATAAGGAGTTCCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014393.1-1679s1c1
Sequence:CCGGCCTCAGATTCTTCATCTGTATCTCGAGATACAGATGAAGAATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183772    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014393.1-3352s1c1
Sequence:CCGGCCCTCATTATTGCATTGCTAACTCGAGTTAGCAATGCAATAATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_014393.1-1440s1c1
Sequence:CCGGCCAACCTTCAAGCTCTTTCTTCTCGAGAAGAAAGAGCTTGAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_014393.1-1426s1c1
Sequence:CCGGCCCAAAGATATGAACCAACCTCTCGAGAGGTTGGTTCATATCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_014393.1-2828s1c1
Sequence:CCGGGCCAGGTAGTTGTTAGTGTTTCTCGAGAAACACTAACAACTACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014393
VALIDATED
STAU2 MISSION shRNA Lentiviral Transduction Particles
staufen double-stranded RNA binding protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014393.1-1030s1c1
Sequence:CCGGATTAGCCGCCTGGCGCAAATTCTCGAGAATTTGCGCCAGGCGGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014393.1-1158s1c1
Sequence:CCGGTACAGGAACAGGACCTAATAACTCGAGTTATTAGGTCCTGTTCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014393.1-369s1c1
Sequence:CCGGCAATAACCCAGGCAGTATAACCTCGAGGTTATACTGCCTGGGTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014393.1-327s1c1
Sequence:CCGGGCTTCCCAAACCAGTTCAGAACTCGAGTTCTGAACTGGTTTGGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_014393.1-1498s1c1
Sequence:CCGGGCCAGGGAACTCCTTATGAATCTCGAGATTCATAAGGAGTTCCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014393.1-1679s1c1
Sequence:CCGGCCTCAGATTCTTCATCTGTATCTCGAGATACAGATGAAGAATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183772    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014393.1-3352s1c1
Sequence:CCGGCCCTCATTATTGCATTGCTAACTCGAGTTAGCAATGCAATAATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_014393.1-1440s1c1
Sequence:CCGGCCAACCTTCAAGCTCTTTCTTCTCGAGAAGAAAGAGCTTGAAGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_014393.1-1426s1c1
Sequence:CCGGCCCAAAGATATGAACCAACCTCTCGAGAGGTTGGTTCATATCTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_014393.1-2828s1c1
Sequence:CCGGGCCAGGTAGTTGTTAGTGTTTCTCGAGAAACACTAACAACTACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks