EMAIL THIS PAGE TO A FRIEND

STBD1

starch binding domain 1

Synonyms: GENEX3414
UniProtKB ID: O95210, B3KVZ9
Gene ID:
Mouse(52331) starch binding domain 1
Rat(305234) starch binding domain 1
cow(513376) starch binding domain 1
sheep(101109540) starch binding domain 1
domestic guinea pig(100716579) starch binding domain 1
chicken(422637) starch binding domain 1
dog(487814) starch binding domain 1
domestic cat(101091107) starch binding domain 1
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003943 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003943 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003943 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175096 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175096 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175096 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003943 Rosetta Predictions human pricing
NM_001013988 Rosetta Predictions rat pricing
NM_175096 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083047 predicted 383
2 SASI_Hs01_00083048 predicted 517
3 SASI_Hs01_00083050 predicted 946
4 SASI_Hs02_00336598 predicted 1110
5 SASI_Hs01_00083051 predicted 1001
6 SASI_Hs01_00083052 predicted 1080
7 SASI_Hs01_00083053 predicted 1122
8 SASI_Hs02_00336599 predicted 726
9 SASI_Hs01_00083055 predicted 1062
10 SASI_Hs02_00336600 predicted 329
11 SASI_Hs01_00083049 predicted 735
12 SASI_Hs01_00083054 predicted 781
13 SASI_Hs01_00083056 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031782 predicted 933
2 SASI_Rn01_00031783 predicted 450
3 SASI_Rn02_00201340 predicted 1120
4 SASI_Rn01_00031784 predicted 859
5 SASI_Rn01_00031785 predicted 492
6 SASI_Rn01_00031786 predicted 1044
7 SASI_Rn01_00031787 predicted 291
8 SASI_Rn02_00201341 predicted 699
9 SASI_Rn01_00031788 predicted 982
10 SASI_Rn01_00031789 predicted 1110
11 SASI_Rn01_00031781 predicted 1127
12 SASI_Rn01_00031790 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345688 predicted 967
2 SASI_Mm02_00345689 predicted 310
3 SASI_Mm01_00175683 predicted 696
4 SASI_Mm01_00175684 predicted 664
5 SASI_Mm01_00175685 predicted 389
6 SASI_Mm01_00175686 predicted 955
7 SASI_Mm02_00345690 predicted 1126
8 SASI_Mm01_00175688 predicted 879
9 SASI_Mm01_00175689 predicted 708
10 SASI_Mm01_00175690 predicted 271
11 SASI_Mm01_00175687 predicted 1006
12 SASI_Mm01_00175691 predicted 779
13 SASI_Mm01_00175692 predicted 775
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003943
VALIDATED
STBD1 MISSION shRNA Bacterial Glycerol Stock
starch binding domain 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_003943.1-802s1c1
Sequence:CCGGGTTAAACCTAAACCAGGGAATCTCGAGATTCCCTGGTTTAGGTTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003943.1-956s1c1
Sequence:CCGGGATGTGCAATTCATTGCAGTACTCGAGTACTGCAATGAATTGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003943.1-1431s1c1
Sequence:CCGGCCAGTGAATGTGAACTTCTTTCTCGAGAAAGAAGTTCACATTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003943.1-363s1c1
Sequence:CCGGGCAATGGACATTTGATTTCTACTCGAGTAGAAATCAAATGTCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143776    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003943.1-1889s1c1
Sequence:CCGGGTGTAGAAACAAAGGGCCTAACTCGAGTTAGGCCCTTTGTTTCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003943.1-519s1c1
Sequence:CCGGCCAGTAACTCTAGGAGTTACTCTCGAGAGTAACTCCTAGAGTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003943.1-1827s1c1
Sequence:CCGGCCAGGCGTTGTTATGTGCTATCTCGAGATAGCACATAACAACGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003943.1-1125s1c1
Sequence:CCGGGCTGGGAAGAATGCAGCAATACTCGAGTATTGCTGCATTCTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003943.1-335s1c1
Sequence:CCGGGTCACCAAACCAGAGCATCTTCTCGAGAAGATGCTCTGGTTTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003943
VALIDATED
STBD1 MISSION shRNA shRNA Plasmid DNA
starch binding domain 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_003943.1-802s1c1
Sequence:CCGGGTTAAACCTAAACCAGGGAATCTCGAGATTCCCTGGTTTAGGTTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003943.1-956s1c1
Sequence:CCGGGATGTGCAATTCATTGCAGTACTCGAGTACTGCAATGAATTGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003943.1-1431s1c1
Sequence:CCGGCCAGTGAATGTGAACTTCTTTCTCGAGAAAGAAGTTCACATTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003943.1-363s1c1
Sequence:CCGGGCAATGGACATTTGATTTCTACTCGAGTAGAAATCAAATGTCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143776    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003943.1-1889s1c1
Sequence:CCGGGTGTAGAAACAAAGGGCCTAACTCGAGTTAGGCCCTTTGTTTCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003943.1-519s1c1
Sequence:CCGGCCAGTAACTCTAGGAGTTACTCTCGAGAGTAACTCCTAGAGTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003943.1-1827s1c1
Sequence:CCGGCCAGGCGTTGTTATGTGCTATCTCGAGATAGCACATAACAACGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003943.1-1125s1c1
Sequence:CCGGGCTGGGAAGAATGCAGCAATACTCGAGTATTGCTGCATTCTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003943.1-335s1c1
Sequence:CCGGGTCACCAAACCAGAGCATCTTCTCGAGAAGATGCTCTGGTTTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003943
VALIDATED
STBD1 MISSION shRNA Lentiviral Transduction Particles
starch binding domain 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_003943.1-802s1c1
Sequence:CCGGGTTAAACCTAAACCAGGGAATCTCGAGATTCCCTGGTTTAGGTTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003943.1-956s1c1
Sequence:CCGGGATGTGCAATTCATTGCAGTACTCGAGTACTGCAATGAATTGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003943.1-1431s1c1
Sequence:CCGGCCAGTGAATGTGAACTTCTTTCTCGAGAAAGAAGTTCACATTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003943.1-363s1c1
Sequence:CCGGGCAATGGACATTTGATTTCTACTCGAGTAGAAATCAAATGTCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143776    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003943.1-1889s1c1
Sequence:CCGGGTGTAGAAACAAAGGGCCTAACTCGAGTTAGGCCCTTTGTTTCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003943.1-519s1c1
Sequence:CCGGCCAGTAACTCTAGGAGTTACTCTCGAGAGTAACTCCTAGAGTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003943.1-1827s1c1
Sequence:CCGGCCAGGCGTTGTTATGTGCTATCTCGAGATAGCACATAACAACGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003943.1-1125s1c1
Sequence:CCGGGCTGGGAAGAATGCAGCAATACTCGAGTATTGCTGCATTCTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003943.1-335s1c1
Sequence:CCGGGTCACCAAACCAGAGCATCTTCTCGAGAAGATGCTCTGGTTTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175096
VALIDATED
STBD1 MISSION shRNA Bacterial Glycerol Stock
starch binding domain 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175096.2-681s1c1
Sequence:CCGGGCTTCTAGGTTAAGTCTAAATCTCGAGATTTAGACTTAACCTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175096.2-1605s1c1
Sequence:CCGGCCTTTGTCTTAGTGGCTGAAACTCGAGTTTCAGCCACTAAGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175096.2-678s1c1
Sequence:CCGGGAGGCTTCTAGGTTAAGTCTACTCGAGTAGACTTAACCTAGAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175096.2-294s1c1
Sequence:CCGGCTTCGAGAAAGCAACGGACATCTCGAGATGTCCGTTGCTTTCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175096.3-293s21c1
Sequence:CCGGCTTCGAGAAAGCAACGGACATCTCGAGATGTCCGTTGCTTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175096.3-677s21c1
Sequence:CCGGGAGGCTTCTAGGTTAAGTCTACTCGAGTAGACTTAACCTAGAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175096.3-1604s21c1
Sequence:CCGGCCTTTGTCTTAGTGGCTGAAACTCGAGTTTCAGCCACTAAGACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175096.3-1001s21c1
Sequence:CCGGGAAGAATGCAGCAATAGATTCCTCGAGGAATCTATTGCTGCATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175096
VALIDATED
STBD1 MISSION shRNA shRNA Plasmid DNA
starch binding domain 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175096.2-681s1c1
Sequence:CCGGGCTTCTAGGTTAAGTCTAAATCTCGAGATTTAGACTTAACCTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175096.2-1605s1c1
Sequence:CCGGCCTTTGTCTTAGTGGCTGAAACTCGAGTTTCAGCCACTAAGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175096.2-678s1c1
Sequence:CCGGGAGGCTTCTAGGTTAAGTCTACTCGAGTAGACTTAACCTAGAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175096.2-294s1c1
Sequence:CCGGCTTCGAGAAAGCAACGGACATCTCGAGATGTCCGTTGCTTTCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175096.3-293s21c1
Sequence:CCGGCTTCGAGAAAGCAACGGACATCTCGAGATGTCCGTTGCTTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175096.3-677s21c1
Sequence:CCGGGAGGCTTCTAGGTTAAGTCTACTCGAGTAGACTTAACCTAGAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175096.3-1604s21c1
Sequence:CCGGCCTTTGTCTTAGTGGCTGAAACTCGAGTTTCAGCCACTAAGACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175096.3-1001s21c1
Sequence:CCGGGAAGAATGCAGCAATAGATTCCTCGAGGAATCTATTGCTGCATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175096
VALIDATED
STBD1 MISSION shRNA Lentiviral Transduction Particles
starch binding domain 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175096.2-681s1c1
Sequence:CCGGGCTTCTAGGTTAAGTCTAAATCTCGAGATTTAGACTTAACCTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175096.2-1605s1c1
Sequence:CCGGCCTTTGTCTTAGTGGCTGAAACTCGAGTTTCAGCCACTAAGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175096.2-678s1c1
Sequence:CCGGGAGGCTTCTAGGTTAAGTCTACTCGAGTAGACTTAACCTAGAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175096.2-294s1c1
Sequence:CCGGCTTCGAGAAAGCAACGGACATCTCGAGATGTCCGTTGCTTTCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175096.3-293s21c1
Sequence:CCGGCTTCGAGAAAGCAACGGACATCTCGAGATGTCCGTTGCTTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175096.3-677s21c1
Sequence:CCGGGAGGCTTCTAGGTTAAGTCTACTCGAGTAGACTTAACCTAGAAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175096.3-1604s21c1
Sequence:CCGGCCTTTGTCTTAGTGGCTGAAACTCGAGTTTCAGCCACTAAGACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175096.3-1001s21c1
Sequence:CCGGGAAGAATGCAGCAATAGATTCCTCGAGGAATCTATTGCTGCATTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks