EMAIL THIS PAGE TO A FRIEND

STC1

stanniocalcin 1

Synonyms: STC
UniProtKB ID: P52823
Gene ID:
Human(6781) Summary: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conserved cysteine residues and is phosphorylated by protein kinase C exclusively on its serine residues. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Overexpression of human stanniocalcin 1 in mice produces high serum phosphate levels, dwarfism, and increased metabolic rate. This gene has altered expression in hepatocellular, ovarian, and breast cancers. [provided by RefSeq, Jul 2008]
Mouse(20855) stanniocalcin 1
Rat(81801) stanniocalcin 1
Zebrafish(751747) stanniocalcin 1
domestic cat(101083584) stanniocalcin 1
dog(486112) stanniocalcin 1
chicken(428201) stanniocalcin 1
naked mole-rat(101702749) stanniocalcin 1
cow(338078) stanniocalcin 1
sheep(100294584) stanniocalcin 1
sheep(101112949) stanniocalcin 1
298 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009285 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009285 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009285 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003155 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003155 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003155 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003155 Rosetta Predictions human pricing
NM_031123 Rosetta Predictions rat pricing
NM_009285 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016078 predicted 1453
2 SASI_Hs02_00335158 predicted 747
3 SASI_Hs02_00335159 predicted 1437
4 SASI_Hs01_00016080 predicted 1189
5 SASI_Hs01_00016082 predicted 511
6 SASI_Hs02_00335160 predicted 1022
7 SASI_Hs01_00016083 predicted 1160
8 SASI_Hs01_00016084 predicted 1490
9 SASI_Hs02_00335161 predicted 1506
10 SASI_Hs01_00016086 predicted 488
11 SASI_Hs01_00016077 predicted 1033
12 SASI_Hs01_00016079 predicted 1028
13 SASI_Hs01_00016081 predicted 745
14 SASI_Hs01_00016085 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044448 predicted 1386
2 SASI_Rn01_00044449 predicted 1410
3 SASI_Rn01_00044450 predicted 1486
4 SASI_Rn01_00044451 predicted 538
5 SASI_Rn01_00044453 predicted 1314
6 SASI_Rn01_00044454 predicted 1471
7 SASI_Rn01_00044455 predicted 719
8 SASI_Rn01_00044456 predicted 1442
9 SASI_Rn01_00044457 predicted 519
10 SASI_Rn02_00264435 predicted 1480
11 SASI_Rn01_00044452 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009285 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050428 predicted 384
2 SASI_Mm02_00315788 predicted 548
3 SASI_Mm02_00315789 predicted 1153
4 SASI_Mm01_00050431 predicted 406
5 SASI_Mm01_00050432 predicted 1329
6 SASI_Mm02_00315790 predicted 1315
7 SASI_Mm01_00050434 predicted 568
8 SASI_Mm02_00315791 predicted 1286
9 SASI_Mm02_00315792 predicted 291
10 SASI_Mm02_00315793 predicted 330
11 SASI_Mm01_00050425 predicted 652
12 SASI_Mm01_00050426 predicted 356
13 SASI_Mm01_00050427 predicted 611
14 SASI_Mm01_00050429 predicted 579
15 SASI_Mm01_00050430 predicted 535
16 SASI_Mm01_00050433 predicted 1285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009285
STC1 MISSION shRNA Bacterial Glycerol Stock
stanniocalcin 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009285.3-615s21c1
Sequence:CCGGGAAGACACGGTCAGTACAATCCTCGAGGATTGTACTGACCGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009285.3-371s21c1
Sequence:CCGGATTTGTCAAAGAGAGCTTAAACTCGAGTTTAAGCTCTCTTTGACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009285.3-840s21c1
Sequence:CCGGGCGTAAGCAGGGAGAGGTATTCTCGAGAATACCTCTCCCTGCTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009285.3-989s21c1
Sequence:CCGGACTAGGCTTCCATAATCAATACTCGAGTATTGATTATGGAAGCCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009285.3-916s21c1
Sequence:CCGGGTACTGTGCCTGGTTTGATTTCTCGAGAAATCAAACCAGGCACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009285.3-485s21c1
Sequence:CCGGCTACAGCAAGCTTAACGTTTGCTCGAGCAAACGTTAAGCTTGCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009285.2-3817s1c1
Sequence:CCGGCCCACGTCTTTCATTGTTATTCTCGAGAATAACAATGAAAGACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009285.2-363s1c1
Sequence:CCGGGTACGACATTTGTAAATCCTTCTCGAGAAGGATTTACAAATGTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009285.2-466s1c1
Sequence:CCGGTCCAAGGTATTCCTTGCCATTCTCGAGAATGGCAAGGAATACCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009285.2-615s1c1
Sequence:CCGGCTTCTCCAACAGATACTACAACTCGAGTTGTAGTATCTGTTGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009285.2-795s1c1
Sequence:CCGGGCGTACAAATGAGCCACAGAACTCGAGTTCTGTGGCTCATTTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009285
STC1 MISSION shRNA shRNA Plasmid DNA
stanniocalcin 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009285.3-615s21c1
Sequence:CCGGGAAGACACGGTCAGTACAATCCTCGAGGATTGTACTGACCGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009285.3-371s21c1
Sequence:CCGGATTTGTCAAAGAGAGCTTAAACTCGAGTTTAAGCTCTCTTTGACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009285.3-840s21c1
Sequence:CCGGGCGTAAGCAGGGAGAGGTATTCTCGAGAATACCTCTCCCTGCTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009285.3-989s21c1
Sequence:CCGGACTAGGCTTCCATAATCAATACTCGAGTATTGATTATGGAAGCCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009285.3-916s21c1
Sequence:CCGGGTACTGTGCCTGGTTTGATTTCTCGAGAAATCAAACCAGGCACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009285.3-485s21c1
Sequence:CCGGCTACAGCAAGCTTAACGTTTGCTCGAGCAAACGTTAAGCTTGCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009285.2-3817s1c1
Sequence:CCGGCCCACGTCTTTCATTGTTATTCTCGAGAATAACAATGAAAGACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009285.2-363s1c1
Sequence:CCGGGTACGACATTTGTAAATCCTTCTCGAGAAGGATTTACAAATGTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009285.2-466s1c1
Sequence:CCGGTCCAAGGTATTCCTTGCCATTCTCGAGAATGGCAAGGAATACCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009285.2-615s1c1
Sequence:CCGGCTTCTCCAACAGATACTACAACTCGAGTTGTAGTATCTGTTGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009285.2-795s1c1
Sequence:CCGGGCGTACAAATGAGCCACAGAACTCGAGTTCTGTGGCTCATTTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009285
STC1 MISSION shRNA Lentiviral Transduction Particles
stanniocalcin 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009285.3-615s21c1
Sequence:CCGGGAAGACACGGTCAGTACAATCCTCGAGGATTGTACTGACCGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009285.3-371s21c1
Sequence:CCGGATTTGTCAAAGAGAGCTTAAACTCGAGTTTAAGCTCTCTTTGACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009285.3-840s21c1
Sequence:CCGGGCGTAAGCAGGGAGAGGTATTCTCGAGAATACCTCTCCCTGCTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009285.3-989s21c1
Sequence:CCGGACTAGGCTTCCATAATCAATACTCGAGTATTGATTATGGAAGCCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009285.3-916s21c1
Sequence:CCGGGTACTGTGCCTGGTTTGATTTCTCGAGAAATCAAACCAGGCACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009285.3-485s21c1
Sequence:CCGGCTACAGCAAGCTTAACGTTTGCTCGAGCAAACGTTAAGCTTGCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009285.2-3817s1c1
Sequence:CCGGCCCACGTCTTTCATTGTTATTCTCGAGAATAACAATGAAAGACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009285.2-363s1c1
Sequence:CCGGGTACGACATTTGTAAATCCTTCTCGAGAAGGATTTACAAATGTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009285.2-466s1c1
Sequence:CCGGTCCAAGGTATTCCTTGCCATTCTCGAGAATGGCAAGGAATACCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009285.2-615s1c1
Sequence:CCGGCTTCTCCAACAGATACTACAACTCGAGTTGTAGTATCTGTTGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009285.2-795s1c1
Sequence:CCGGGCGTACAAATGAGCCACAGAACTCGAGTTCTGTGGCTCATTTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003155
STC1 MISSION shRNA Bacterial Glycerol Stock
stanniocalcin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003155.2-917s21c1
Sequence:CCGGCAACAGGAGACGCACCAATGACTCGAGTCATTGGTGCGTCTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003155.2-1433s21c1
Sequence:CCGGGCATGTCTTAAATGCTCATAACTCGAGTTATGAGCATTTAAGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003155.2-1486s21c1
Sequence:CCGGTGCTGGCCATGGACGAATATGCTCGAGCATATTCGTCCATGGCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003155.1-1007s1c1
Sequence:CCGGCACATCCCATGAGAGTGCATACTCGAGTATGCACTCTCATGGGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003155.1-635s1c1
Sequence:CCGGCCAAAGGATGATTGCTGAGGTCTCGAGACCTCAGCAATCATCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003155.1-552s1c1
Sequence:CCGGGCATTCGTCAAAGAGAGCTTACTCGAGTAAGCTCTCTTTGACGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003155.1-486s1c1
Sequence:CCGGGATGGGATGTATGACATCTGTCTCGAGACAGATGTCATACATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003155.1-529s1c1
Sequence:CCGGCTAAATTTGACACTCAGGGAACTCGAGTTCCCTGAGTGTCAAATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003155
STC1 MISSION shRNA shRNA Plasmid DNA
stanniocalcin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003155.2-917s21c1
Sequence:CCGGCAACAGGAGACGCACCAATGACTCGAGTCATTGGTGCGTCTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003155.2-1433s21c1
Sequence:CCGGGCATGTCTTAAATGCTCATAACTCGAGTTATGAGCATTTAAGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003155.2-1486s21c1
Sequence:CCGGTGCTGGCCATGGACGAATATGCTCGAGCATATTCGTCCATGGCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003155.1-1007s1c1
Sequence:CCGGCACATCCCATGAGAGTGCATACTCGAGTATGCACTCTCATGGGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003155.1-635s1c1
Sequence:CCGGCCAAAGGATGATTGCTGAGGTCTCGAGACCTCAGCAATCATCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003155.1-552s1c1
Sequence:CCGGGCATTCGTCAAAGAGAGCTTACTCGAGTAAGCTCTCTTTGACGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003155.1-486s1c1
Sequence:CCGGGATGGGATGTATGACATCTGTCTCGAGACAGATGTCATACATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003155.1-529s1c1
Sequence:CCGGCTAAATTTGACACTCAGGGAACTCGAGTTCCCTGAGTGTCAAATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003155
STC1 MISSION shRNA Lentiviral Transduction Particles
stanniocalcin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003155.2-917s21c1
Sequence:CCGGCAACAGGAGACGCACCAATGACTCGAGTCATTGGTGCGTCTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003155.2-1433s21c1
Sequence:CCGGGCATGTCTTAAATGCTCATAACTCGAGTTATGAGCATTTAAGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003155.2-1486s21c1
Sequence:CCGGTGCTGGCCATGGACGAATATGCTCGAGCATATTCGTCCATGGCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003155.1-1007s1c1
Sequence:CCGGCACATCCCATGAGAGTGCATACTCGAGTATGCACTCTCATGGGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003155.1-635s1c1
Sequence:CCGGCCAAAGGATGATTGCTGAGGTCTCGAGACCTCAGCAATCATCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003155.1-552s1c1
Sequence:CCGGGCATTCGTCAAAGAGAGCTTACTCGAGTAAGCTCTCTTTGACGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003155.1-486s1c1
Sequence:CCGGGATGGGATGTATGACATCTGTCTCGAGACAGATGTCATACATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003155.1-529s1c1
Sequence:CCGGCTAAATTTGACACTCAGGGAACTCGAGTTCCCTGAGTGTCAAATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks