EMAIL THIS PAGE TO A FRIEND

STC2

stanniocalcin 2

Synonyms: STC-2 STCRP
UniProtKB ID: O76061
Gene ID:
Human(8614) Summary: This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers. [provided by RefSeq, Jul 2008]
Mouse(20856) stanniocalcin 2
Rat(63878) stanniocalcin 2
chicken(416208) stanniocalcin 2
domestic cat(101090485) stanniocalcin 2
dog(489112) stanniocalcin 2
cow(540573) stanniocalcin 2
sheep(101109910) stanniocalcin 2
naked mole-rat(101723645) stanniocalcin 2
201 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22017 Anti-ATC2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA045372 Anti-STC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1409924 Monoclonal Anti-STC-2 antibody produced in mouse clone 4D9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409925 Monoclonal Anti-STC-2 antibody produced in mouse clone 4B3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409926 Monoclonal Anti-STC-2 antibody produced in mouse clone 3E4, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409927 Monoclonal Anti-STC-2 antibody produced in mouse clone 4H7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409928 Monoclonal Anti-STC-2 antibody produced in mouse clone 2A9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409929 Monoclonal Anti-STC-2 antibody produced in mouse clone 4B9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409930 Monoclonal Anti-STC-2 antibody produced in mouse clone 1F5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409931 Monoclonal Anti-STC-2 antibody produced in mouse clone 2F11, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409932 Monoclonal Anti-STC-2 antibody produced in mouse clone 2G3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409933 Monoclonal Anti-STC-2 antibody produced in mouse clone 3B7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409934 Monoclonal Anti-STC-2 antibody produced in mouse clone 1E4, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409935 Monoclonal Anti-STC-2 antibody produced in mouse clone 3E2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409936 Monoclonal Anti-STC-2 antibody produced in mouse clone 1F3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409937 Monoclonal Anti-STC-2 antibody produced in mouse clone 2C11, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409938 Monoclonal Anti-STC-2 antibody produced in mouse clone 2G5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409939 Monoclonal Anti-STC-2 antibody produced in mouse clone 4B7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409940 Monoclonal Anti-STC-2 antibody produced in mouse clone 4C2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
WH0008614M8 Monoclonal Anti-STC2 antibody produced in mouse clone 2B11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003714 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011491 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011491 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011491 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003714 Rosetta Predictions human pricing
NM_022230 Rosetta Predictions rat pricing
NM_011491 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025657 predicted 1546
2 SASI_Hs01_00025660 predicted 2448
3 SASI_Hs01_00025661 predicted 2185
4 SASI_Hs01_00025662 predicted 2413
5 SASI_Hs01_00025663 predicted 1810
6 SASI_Hs01_00025664 predicted 2335
7 SASI_Hs01_00025666 predicted 2065
8 SASI_Hs02_00336137 predicted 2459
9 SASI_Hs02_00336138 predicted 1506
10 SASI_Hs02_00336139 predicted 1757
11 SASI_Hs01_00025658 predicted 1506
12 SASI_Hs01_00025659 predicted 1527
13 SASI_Hs01_00025665 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262995 predicted 209
2 SASI_Rn01_00041754 predicted 222
3 SASI_Rn01_00041755 predicted 467
4 SASI_Rn01_00041756 predicted 389
5 SASI_Rn01_00041757 predicted 249
6 SASI_Rn01_00041758 predicted 386
7 SASI_Rn01_00041759 predicted 249
8 SASI_Rn01_00041761 predicted 253
9 SASI_Rn01_00041762 predicted 216
10 SASI_Rn02_00262996 predicted 383
11 SASI_Rn01_00041760 predicted 517
12 SASI_Rn01_00041763 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126689 predicted 1324
2 SASI_Mm01_00126690 predicted 393
3 SASI_Mm01_00126691 predicted 428
4 SASI_Mm01_00126693 predicted 1349
5 SASI_Mm02_00320786 predicted 652
6 SASI_Mm02_00320787 predicted 575
7 SASI_Mm01_00126694 predicted 418
8 SASI_Mm01_00126695 predicted 1051
9 SASI_Mm01_00126696 predicted 1099
10 SASI_Mm01_00126697 predicted 701
11 SASI_Mm01_00126692 predicted 412
12 SASI_Mm01_00126698 predicted 540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003714
VALIDATED
STC2 MISSION shRNA Bacterial Glycerol Stock
stanniocalcin 2
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003714.1-339s1c1
Sequence:CCGGGAATGTTTCGAGAACAACTCTCTCGAGAGAGTTGTTCTCGAAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003714.1-332s1c1
Sequence:CCGGCGTGTTTGAATGTTTCGAGAACTCGAGTTCTCGAAACATTCAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003714.1-348s1c1
Sequence:CCGGGAGAACAACTCTTGTGAGATTCTCGAGAATCTCACAAGAGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003714.1-608s1c1
Sequence:CCGGGATGATCCATTTCAAGGACTTCTCGAGAAGTCCTTGAAATGGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003714.1-599s1c1
Sequence:CCGGGATAGTGGAGATGATCCATTTCTCGAGAAATGGATCATCTCCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003714.2-4789s1c1
Sequence:CCGGGCAAGCATTGATTGAGACATTCTCGAGAATGTCTCAATCAATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003714.1-1011s1c1
Sequence:CCGGGAACAGTCTGAGTATTCTGATCTCGAGATCAGAATACTCAGACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003714.1-1005s1c1
Sequence:CCGGGAAGACGAACAGTCTGAGTATCTCGAGATACTCAGACTGTTCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003714.1-347s1c1
Sequence:CCGGCGAGAACAACTCTTGTGAGATCTCGAGATCTCACAAGAGTTGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003714.1-425s1c1
Sequence:CCGGCCAGGGCAAGTCATTCATCAACTCGAGTTGATGAATGACTTGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003714.1-434s1c1
Sequence:CCGGGTCATTCATCAAAGACGCCTTCTCGAGAAGGCGTCTTTGATGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003714.1-426s1c1
Sequence:CCGGCAGGGCAAGTCATTCATCAAACTCGAGTTTGATGAATGACTTGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003714.2-2244s21c1
Sequence:CCGGTTTCCTCCACGCCGTCCATTTCTCGAGAAATGGACGGCGTGGAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003714.2-1820s21c1
Sequence:CCGGCTACGTGGACCTCGTGAACTTCTCGAGAAGTTCACGAGGTCCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003714.2-2187s21c1
Sequence:CCGGGAACAGTCTGAGTATTCTGATCTCGAGATCAGAATACTCAGACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003714.2-1603s21c1
Sequence:CCGGAGGGCAAGTCATTCATCAAAGCTCGAGCTTTGATGAATGACTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003714.2-1776s21c1
Sequence:CCGGATAGTGGAGATGATCCATTTCCTCGAGGAAATGGATCATCTCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003714
VALIDATED
STC2 MISSION shRNA shRNA Plasmid DNA
stanniocalcin 2
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003714.1-339s1c1
Sequence:CCGGGAATGTTTCGAGAACAACTCTCTCGAGAGAGTTGTTCTCGAAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003714.1-332s1c1
Sequence:CCGGCGTGTTTGAATGTTTCGAGAACTCGAGTTCTCGAAACATTCAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003714.1-348s1c1
Sequence:CCGGGAGAACAACTCTTGTGAGATTCTCGAGAATCTCACAAGAGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003714.1-608s1c1
Sequence:CCGGGATGATCCATTTCAAGGACTTCTCGAGAAGTCCTTGAAATGGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003714.1-599s1c1
Sequence:CCGGGATAGTGGAGATGATCCATTTCTCGAGAAATGGATCATCTCCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003714.2-4789s1c1
Sequence:CCGGGCAAGCATTGATTGAGACATTCTCGAGAATGTCTCAATCAATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003714.1-1011s1c1
Sequence:CCGGGAACAGTCTGAGTATTCTGATCTCGAGATCAGAATACTCAGACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003714.1-1005s1c1
Sequence:CCGGGAAGACGAACAGTCTGAGTATCTCGAGATACTCAGACTGTTCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003714.1-347s1c1
Sequence:CCGGCGAGAACAACTCTTGTGAGATCTCGAGATCTCACAAGAGTTGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003714.1-425s1c1
Sequence:CCGGCCAGGGCAAGTCATTCATCAACTCGAGTTGATGAATGACTTGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003714.1-434s1c1
Sequence:CCGGGTCATTCATCAAAGACGCCTTCTCGAGAAGGCGTCTTTGATGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003714.1-426s1c1
Sequence:CCGGCAGGGCAAGTCATTCATCAAACTCGAGTTTGATGAATGACTTGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003714.2-2244s21c1
Sequence:CCGGTTTCCTCCACGCCGTCCATTTCTCGAGAAATGGACGGCGTGGAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003714.2-1820s21c1
Sequence:CCGGCTACGTGGACCTCGTGAACTTCTCGAGAAGTTCACGAGGTCCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003714.2-2187s21c1
Sequence:CCGGGAACAGTCTGAGTATTCTGATCTCGAGATCAGAATACTCAGACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003714.2-1603s21c1
Sequence:CCGGAGGGCAAGTCATTCATCAAAGCTCGAGCTTTGATGAATGACTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003714.2-1776s21c1
Sequence:CCGGATAGTGGAGATGATCCATTTCCTCGAGGAAATGGATCATCTCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003714
VALIDATED
STC2 MISSION shRNA Lentiviral Transduction Particles
stanniocalcin 2
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003714.1-339s1c1
Sequence:CCGGGAATGTTTCGAGAACAACTCTCTCGAGAGAGTTGTTCTCGAAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003714.1-332s1c1
Sequence:CCGGCGTGTTTGAATGTTTCGAGAACTCGAGTTCTCGAAACATTCAAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003714.1-348s1c1
Sequence:CCGGGAGAACAACTCTTGTGAGATTCTCGAGAATCTCACAAGAGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003714.1-608s1c1
Sequence:CCGGGATGATCCATTTCAAGGACTTCTCGAGAAGTCCTTGAAATGGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003714.1-599s1c1
Sequence:CCGGGATAGTGGAGATGATCCATTTCTCGAGAAATGGATCATCTCCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003714.2-4789s1c1
Sequence:CCGGGCAAGCATTGATTGAGACATTCTCGAGAATGTCTCAATCAATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003714.1-1011s1c1
Sequence:CCGGGAACAGTCTGAGTATTCTGATCTCGAGATCAGAATACTCAGACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003714.1-1005s1c1
Sequence:CCGGGAAGACGAACAGTCTGAGTATCTCGAGATACTCAGACTGTTCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003714.1-347s1c1
Sequence:CCGGCGAGAACAACTCTTGTGAGATCTCGAGATCTCACAAGAGTTGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003714.1-425s1c1
Sequence:CCGGCCAGGGCAAGTCATTCATCAACTCGAGTTGATGAATGACTTGCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003714.1-434s1c1
Sequence:CCGGGTCATTCATCAAAGACGCCTTCTCGAGAAGGCGTCTTTGATGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003714.1-426s1c1
Sequence:CCGGCAGGGCAAGTCATTCATCAAACTCGAGTTTGATGAATGACTTGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003714.2-2244s21c1
Sequence:CCGGTTTCCTCCACGCCGTCCATTTCTCGAGAAATGGACGGCGTGGAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003714.2-1820s21c1
Sequence:CCGGCTACGTGGACCTCGTGAACTTCTCGAGAAGTTCACGAGGTCCACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003714.2-2187s21c1
Sequence:CCGGGAACAGTCTGAGTATTCTGATCTCGAGATCAGAATACTCAGACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003714.2-1603s21c1
Sequence:CCGGAGGGCAAGTCATTCATCAAAGCTCGAGCTTTGATGAATGACTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003714.2-1776s21c1
Sequence:CCGGATAGTGGAGATGATCCATTTCCTCGAGGAAATGGATCATCTCCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011491
STC2 MISSION shRNA Bacterial Glycerol Stock
stanniocalcin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011491.3-411s1c1
Sequence:CCGGTCGAGAACAACTCTTGTGAAACTCGAGTTTCACAAGAGTTGTTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011491.3-412s1c1
Sequence:CCGGCGAGAACAACTCTTGTGAAATCTCGAGATTTCACAAGAGTTGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011491.3-658s1c1
Sequence:CCGGCGGTGTGATTGTGGAGATGATCTCGAGATCATCTCCACAATCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011491.3-564s1c1
Sequence:CCGGGCAGGAAGTGTCCAGCAATTACTCGAGTAATTGCTGGACACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011491.3-1562s1c1
Sequence:CCGGCGGAAGTTTAGTGTCGTGCATCTCGAGATGCACGACACTAAACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011491
STC2 MISSION shRNA shRNA Plasmid DNA
stanniocalcin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011491.3-411s1c1
Sequence:CCGGTCGAGAACAACTCTTGTGAAACTCGAGTTTCACAAGAGTTGTTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011491.3-412s1c1
Sequence:CCGGCGAGAACAACTCTTGTGAAATCTCGAGATTTCACAAGAGTTGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011491.3-658s1c1
Sequence:CCGGCGGTGTGATTGTGGAGATGATCTCGAGATCATCTCCACAATCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011491.3-564s1c1
Sequence:CCGGGCAGGAAGTGTCCAGCAATTACTCGAGTAATTGCTGGACACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011491.3-1562s1c1
Sequence:CCGGCGGAAGTTTAGTGTCGTGCATCTCGAGATGCACGACACTAAACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011491
STC2 MISSION shRNA Lentiviral Transduction Particles
stanniocalcin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011491.3-411s1c1
Sequence:CCGGTCGAGAACAACTCTTGTGAAACTCGAGTTTCACAAGAGTTGTTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011491.3-412s1c1
Sequence:CCGGCGAGAACAACTCTTGTGAAATCTCGAGATTTCACAAGAGTTGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011491.3-658s1c1
Sequence:CCGGCGGTGTGATTGTGGAGATGATCTCGAGATCATCTCCACAATCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011491.3-564s1c1
Sequence:CCGGGCAGGAAGTGTCCAGCAATTACTCGAGTAATTGCTGGACACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011491.3-1562s1c1
Sequence:CCGGCGGAAGTTTAGTGTCGTGCATCTCGAGATGCACGACACTAAACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks