EMAIL THIS PAGE TO A FRIEND

STEAP1

six transmembrane epithelial antigen of the prostate 1

Synonyms: PRSS24 STEAP
UniProtKB ID: Q9UHE8, A4D1E0, O95034
Gene ID:
Human(26872) Summary: This gene is predominantly expressed in prostate tissue, and is found to be upregulated in multiple cancer cell lines. The gene product is predicted to be a six-transmembrane protein, and was shown to be a cell surface antigen significantly expressed at cell-cell junctions. [provided by RefSeq, Jul 2008]
Mouse(70358) six transmembrane epithelial antigen of the prostate 1
Rat(297738) six transmembrane epithelial antigen of the prostate 1
chicken(420540) six transmembrane epithelial antigen of the prostate 1
domestic cat(101080700) six transmembrane epithelial antigen of the prostate 1
dog(475222) six transmembrane epithelial antigen of the prostate 1
domestic guinea pig(100714140) six transmembrane epithelial antigen of the prostate 1
naked mole-rat(101702977) six transmembrane epithelial antigen of the prostate 1
Domestic Rabbit(100328630) six transmembrane epithelial antigen of the prostate 1
cow(515156) six transmembrane epithelial antigen of the prostate 1
sheep(101111709) six transmembrane epithelial antigen of the prostate 1
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012449 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012449 Rosetta Predictions human pricing
NM_001106629 Rosetta Predictions rat pricing
NM_027399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154411 predicted 989
2 SASI_Hs02_00344353 predicted 483
3 SASI_Hs01_00154412 predicted 1090
4 SASI_Hs01_00154413 predicted 977
5 SASI_Hs02_00344354 predicted 603
6 SASI_Hs02_00344355 predicted 566
7 SASI_Hs01_00154415 predicted 784
8 SASI_Hs01_00154416 predicted 646
9 SASI_Hs02_00344356 predicted 543
10 SASI_Hs01_00154418 predicted 655
11 SASI_Hs01_00154414 predicted 1020
12 SASI_Hs01_00154417 predicted 933
13 SASI_Hs01_00154419 predicted 1093
14 SASI_Hs01_00154420 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220828 predicted 949
2 SASI_Rn02_00220829 predicted 364
3 SASI_Rn02_00220830 predicted 858
4 SASI_Rn02_00220831 predicted 551
5 SASI_Rn02_00220832 predicted 347
6 SASI_Rn02_00220833 predicted 906
7 SASI_Rn02_00220834 predicted 694
8 SASI_Rn02_00220835 predicted 935
9 SASI_Rn02_00220836 predicted 294
10 SASI_Rn02_00220837 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153159 predicted 352
2 SASI_Mm01_00153160 predicted 836
3 SASI_Mm01_00153161 predicted 451
4 SASI_Mm01_00153162 predicted 923
5 SASI_Mm01_00153163 predicted 370
6 SASI_Mm01_00153164 predicted 445
7 SASI_Mm01_00153165 predicted 663
8 SASI_Mm01_00153166 predicted 702
9 SASI_Mm01_00153167 predicted 530
10 SASI_Mm02_00332122 predicted 365
11 SASI_Mm01_00153168 predicted 423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012449
VALIDATED
STEAP1 MISSION shRNA Bacterial Glycerol Stock
six transmembrane epithelial antigen of the prostate 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012449.2-354s21c1
Sequence:CCGGGCTGATGAATTTGACTGCCCTCTCGAGAGGGCAGTCAAATTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012449.2-609s21c1
Sequence:CCGGGCAATTGTCCAACTTCATAATCTCGAGATTATGAAGTTGGACAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012449.2-820s21c1
Sequence:CCGGCCTGGATTGAGCATGATGTTTCTCGAGAAACATCATGCTCAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012449.2-267s21c1
Sequence:CCGGGAAGAAGACGATTATTTGCATCTCGAGATGCAAATAATCGTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_012449.2-473s21c1
Sequence:CCGGGAGGGAAGTAATTCACCCTTTCTCGAGAAAGGGTGAATTACTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012449.2-354s1c1
Sequence:CCGGGCTGATGAATTTGACTGCCCTCTCGAGAGGGCAGTCAAATTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012449.2-1017s1c1
Sequence:CCGGGCCTGGAATAAGTGGATAGATCTCGAGATCTATCCACTTATTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012449.2-609s1c1
Sequence:CCGGGCAATTGTCCAACTTCATAATCTCGAGATTATGAAGTTGGACAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012449.2-994s1c1
Sequence:CCGGGCACAATACACGCATTGATTTCTCGAGAAATCAATGCGTGTATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012449.2-267s1c1
Sequence:CCGGGAAGAAGACGATTATTTGCATCTCGAGATGCAAATAATCGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012449.2-617s1c1
Sequence:CCGGCCAACTTCATAATGGAACCAACTCGAGTTGGTTCCATTATGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012449.2-1019s1c1
Sequence:CCGGCTGGAATAAGTGGATAGATATCTCGAGATATCTATCCACTTATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012449.2-473s1c1
Sequence:CCGGGAGGGAAGTAATTCACCCTTTCTCGAGAAAGGGTGAATTACTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012449.2-820s1c1
Sequence:CCGGCCTGGATTGAGCATGATGTTTCTCGAGAAACATCATGCTCAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012449
VALIDATED
STEAP1 MISSION shRNA shRNA Plasmid DNA
six transmembrane epithelial antigen of the prostate 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012449.2-354s21c1
Sequence:CCGGGCTGATGAATTTGACTGCCCTCTCGAGAGGGCAGTCAAATTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012449.2-609s21c1
Sequence:CCGGGCAATTGTCCAACTTCATAATCTCGAGATTATGAAGTTGGACAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012449.2-820s21c1
Sequence:CCGGCCTGGATTGAGCATGATGTTTCTCGAGAAACATCATGCTCAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012449.2-267s21c1
Sequence:CCGGGAAGAAGACGATTATTTGCATCTCGAGATGCAAATAATCGTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_012449.2-473s21c1
Sequence:CCGGGAGGGAAGTAATTCACCCTTTCTCGAGAAAGGGTGAATTACTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012449.2-354s1c1
Sequence:CCGGGCTGATGAATTTGACTGCCCTCTCGAGAGGGCAGTCAAATTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012449.2-1017s1c1
Sequence:CCGGGCCTGGAATAAGTGGATAGATCTCGAGATCTATCCACTTATTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012449.2-609s1c1
Sequence:CCGGGCAATTGTCCAACTTCATAATCTCGAGATTATGAAGTTGGACAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012449.2-994s1c1
Sequence:CCGGGCACAATACACGCATTGATTTCTCGAGAAATCAATGCGTGTATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012449.2-267s1c1
Sequence:CCGGGAAGAAGACGATTATTTGCATCTCGAGATGCAAATAATCGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012449.2-617s1c1
Sequence:CCGGCCAACTTCATAATGGAACCAACTCGAGTTGGTTCCATTATGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012449.2-1019s1c1
Sequence:CCGGCTGGAATAAGTGGATAGATATCTCGAGATATCTATCCACTTATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012449.2-473s1c1
Sequence:CCGGGAGGGAAGTAATTCACCCTTTCTCGAGAAAGGGTGAATTACTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012449.2-820s1c1
Sequence:CCGGCCTGGATTGAGCATGATGTTTCTCGAGAAACATCATGCTCAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012449
VALIDATED
STEAP1 MISSION shRNA Lentiviral Transduction Particles
six transmembrane epithelial antigen of the prostate 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012449.2-354s21c1
Sequence:CCGGGCTGATGAATTTGACTGCCCTCTCGAGAGGGCAGTCAAATTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012449.2-609s21c1
Sequence:CCGGGCAATTGTCCAACTTCATAATCTCGAGATTATGAAGTTGGACAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_012449.2-820s21c1
Sequence:CCGGCCTGGATTGAGCATGATGTTTCTCGAGAAACATCATGCTCAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012449.2-267s21c1
Sequence:CCGGGAAGAAGACGATTATTTGCATCTCGAGATGCAAATAATCGTCTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_012449.2-473s21c1
Sequence:CCGGGAGGGAAGTAATTCACCCTTTCTCGAGAAAGGGTGAATTACTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012449.2-354s1c1
Sequence:CCGGGCTGATGAATTTGACTGCCCTCTCGAGAGGGCAGTCAAATTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012449.2-1017s1c1
Sequence:CCGGGCCTGGAATAAGTGGATAGATCTCGAGATCTATCCACTTATTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012449.2-609s1c1
Sequence:CCGGGCAATTGTCCAACTTCATAATCTCGAGATTATGAAGTTGGACAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012449.2-994s1c1
Sequence:CCGGGCACAATACACGCATTGATTTCTCGAGAAATCAATGCGTGTATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012449.2-267s1c1
Sequence:CCGGGAAGAAGACGATTATTTGCATCTCGAGATGCAAATAATCGTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012449.2-617s1c1
Sequence:CCGGCCAACTTCATAATGGAACCAACTCGAGTTGGTTCCATTATGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012449.2-1019s1c1
Sequence:CCGGCTGGAATAAGTGGATAGATATCTCGAGATATCTATCCACTTATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012449.2-473s1c1
Sequence:CCGGGAGGGAAGTAATTCACCCTTTCTCGAGAAAGGGTGAATTACTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012449.2-820s1c1
Sequence:CCGGCCTGGATTGAGCATGATGTTTCTCGAGAAACATCATGCTCAATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027399
VALIDATED
STEAP1 MISSION shRNA Bacterial Glycerol Stock
six transmembrane epithelial antigen of the prostate 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027399.2-429s21c1
Sequence:CCGGCCTGGTTATTAACAAAGTCTTCTCGAGAAGACTTTGTTAATAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027399.2-332s21c1
Sequence:CCGGCCATCATATCATCCCTGACTTCTCGAGAAGTCAGGGATGATATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027399.2-469s21c1
Sequence:CCGGCTCTTGGCACTGGTCTATTTGCTCGAGCAAATAGACCAGTGCCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027399.2-832s21c1
Sequence:CCGGACCTGGAGAGAATTTCACTATCTCGAGATAGTGAAATTCTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027399.1-914s1c1
Sequence:CCGGGCCTGGAATAAATGGGTAGATCTCGAGATCTACCCATTTATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027399.1-430s1c1
Sequence:CCGGCCTGGTTATTAACAAAGTCTTCTCGAGAAGACTTTGTTAATAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027399.1-833s1c1
Sequence:CCGGACCTGGAGAGAATTTCACTATCTCGAGATAGTGAAATTCTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027399.1-333s1c1
Sequence:CCGGCCATCATATCATCCCTGACTTCTCGAGAAGTCAGGGATGATATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027399.1-834s1c1
Sequence:CCGGCCTGGAGAGAATTTCACTATACTCGAGTATAGTGAAATTCTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027399
VALIDATED
STEAP1 MISSION shRNA shRNA Plasmid DNA
six transmembrane epithelial antigen of the prostate 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027399.2-429s21c1
Sequence:CCGGCCTGGTTATTAACAAAGTCTTCTCGAGAAGACTTTGTTAATAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027399.2-332s21c1
Sequence:CCGGCCATCATATCATCCCTGACTTCTCGAGAAGTCAGGGATGATATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027399.2-469s21c1
Sequence:CCGGCTCTTGGCACTGGTCTATTTGCTCGAGCAAATAGACCAGTGCCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027399.2-832s21c1
Sequence:CCGGACCTGGAGAGAATTTCACTATCTCGAGATAGTGAAATTCTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027399.1-914s1c1
Sequence:CCGGGCCTGGAATAAATGGGTAGATCTCGAGATCTACCCATTTATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027399.1-430s1c1
Sequence:CCGGCCTGGTTATTAACAAAGTCTTCTCGAGAAGACTTTGTTAATAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027399.1-833s1c1
Sequence:CCGGACCTGGAGAGAATTTCACTATCTCGAGATAGTGAAATTCTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027399.1-333s1c1
Sequence:CCGGCCATCATATCATCCCTGACTTCTCGAGAAGTCAGGGATGATATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027399.1-834s1c1
Sequence:CCGGCCTGGAGAGAATTTCACTATACTCGAGTATAGTGAAATTCTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027399
VALIDATED
STEAP1 MISSION shRNA Lentiviral Transduction Particles
six transmembrane epithelial antigen of the prostate 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027399.2-429s21c1
Sequence:CCGGCCTGGTTATTAACAAAGTCTTCTCGAGAAGACTTTGTTAATAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027399.2-332s21c1
Sequence:CCGGCCATCATATCATCCCTGACTTCTCGAGAAGTCAGGGATGATATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027399.2-469s21c1
Sequence:CCGGCTCTTGGCACTGGTCTATTTGCTCGAGCAAATAGACCAGTGCCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027399.2-832s21c1
Sequence:CCGGACCTGGAGAGAATTTCACTATCTCGAGATAGTGAAATTCTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027399.1-914s1c1
Sequence:CCGGGCCTGGAATAAATGGGTAGATCTCGAGATCTACCCATTTATTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027399.1-430s1c1
Sequence:CCGGCCTGGTTATTAACAAAGTCTTCTCGAGAAGACTTTGTTAATAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027399.1-833s1c1
Sequence:CCGGACCTGGAGAGAATTTCACTATCTCGAGATAGTGAAATTCTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027399.1-333s1c1
Sequence:CCGGCCATCATATCATCCCTGACTTCTCGAGAAGTCAGGGATGATATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027399.1-834s1c1
Sequence:CCGGCCTGGAGAGAATTTCACTATACTCGAGTATAGTGAAATTCTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks