EMAIL THIS PAGE TO A FRIEND

STEAP1B

STEAP family member 1B

Species: Human STEAP1B(256227)
UniProtKB ID: Q6NZ63
Gene ID:
9 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207342 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721690 Rosetta Predictions human pricing
XM_001723293 Rosetta Predictions human pricing
XM_001724556 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00444407 predicted 1200
2 SASI_Hs02_00444408 predicted 1309
3 SASI_Hs02_00444409 predicted 2
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00454525 predicted 1205
2 SASI_Hs02_00454526 predicted 1310
3 SASI_Hs02_00454527 predicted 3
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00462438 predicted 1204
2 SASI_Hs02_00462439 predicted 1311
3 SASI_Hs02_00462440 predicted 3
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207342
STEAP1B MISSION shRNA Bacterial Glycerol Stock
STEAP family member 1B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-351s21c1
Sequence:CCGGCAGTGGCACTTGCCAATTAAACTCGAGTTTAATTGGCAAGTGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-882s21c1
Sequence:CCGGTGGAGAGAATTTCACTATATTCTCGAGAATATAGTGAAATTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207342.2-939s21c1
Sequence:CCGGCAGATCCTGCCAGTAACATGACTCGAGTCATGTTACTGGCAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-657s21c1
Sequence:CCGGGCTGTACTGCATGCAATTTATCTCGAGATAAATTGCATGCAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-837s21c1
Sequence:CCGGCTGTTGGCTGTGACATCTATTCTCGAGAATAGATGTCACAGCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-512s21c1
Sequence:CCGGCACTCTCTTGGCATTGGTTTACTCGAGTAAACCAATGCCAAGAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-566s21c1
Sequence:CCGGTCATAATGGAACCAAGTATAACTCGAGTTATACTTGGTTCCATTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-591s21c1
Sequence:CCGGTTTCCACATTGGTTGGATAAGCTCGAGCTTATCCAACCAATGTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207342
STEAP1B MISSION shRNA shRNA Plasmid DNA
STEAP family member 1B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-351s21c1
Sequence:CCGGCAGTGGCACTTGCCAATTAAACTCGAGTTTAATTGGCAAGTGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-882s21c1
Sequence:CCGGTGGAGAGAATTTCACTATATTCTCGAGAATATAGTGAAATTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207342.2-939s21c1
Sequence:CCGGCAGATCCTGCCAGTAACATGACTCGAGTCATGTTACTGGCAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-657s21c1
Sequence:CCGGGCTGTACTGCATGCAATTTATCTCGAGATAAATTGCATGCAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-837s21c1
Sequence:CCGGCTGTTGGCTGTGACATCTATTCTCGAGAATAGATGTCACAGCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-512s21c1
Sequence:CCGGCACTCTCTTGGCATTGGTTTACTCGAGTAAACCAATGCCAAGAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-566s21c1
Sequence:CCGGTCATAATGGAACCAAGTATAACTCGAGTTATACTTGGTTCCATTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-591s21c1
Sequence:CCGGTTTCCACATTGGTTGGATAAGCTCGAGCTTATCCAACCAATGTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207342
STEAP1B MISSION shRNA Lentiviral Transduction Particles
STEAP family member 1B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-351s21c1
Sequence:CCGGCAGTGGCACTTGCCAATTAAACTCGAGTTTAATTGGCAAGTGCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-882s21c1
Sequence:CCGGTGGAGAGAATTTCACTATATTCTCGAGAATATAGTGAAATTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207342.2-939s21c1
Sequence:CCGGCAGATCCTGCCAGTAACATGACTCGAGTCATGTTACTGGCAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-657s21c1
Sequence:CCGGGCTGTACTGCATGCAATTTATCTCGAGATAAATTGCATGCAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-837s21c1
Sequence:CCGGCTGTTGGCTGTGACATCTATTCTCGAGAATAGATGTCACAGCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-512s21c1
Sequence:CCGGCACTCTCTTGGCATTGGTTTACTCGAGTAAACCAATGCCAAGAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-566s21c1
Sequence:CCGGTCATAATGGAACCAAGTATAACTCGAGTTATACTTGGTTCCATTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207342.2-591s21c1
Sequence:CCGGTTTCCACATTGGTTGGATAAGCTCGAGCTTATCCAACCAATGTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks