EMAIL THIS PAGE TO A FRIEND

STEAP2

STEAP family member 2, metalloreductase

Synonyms: IPCA1 PCANAP1 PUMPCn STAMP1 STMP
UniProtKB ID: Q8NFT2, A4D1F1, G5E9C6, Q6UXN6, Q6YPB1, Q8IUE7
Gene ID:
Human(261729) Summary: This gene is a member of the STEAP family and encodes a multi-pass membrane protein that localizes to the Golgi complex, the plasma membrane, and the vesicular tubular structures in the cytosol. A highly similar protein in mouse has both ferrireductase and cupric reductase activity, and stimulates the cellular uptake of both iron and copper in vitro. Increased transcriptional expression of the human gene is associated with prostate cancer progression. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(74051) six transmembrane epithelial antigen of prostate 2
Rat(312052) STEAP family member 2, metalloreductase
Zebrafish(100151287) six transmembrane epithelial antigen of the prostate 2
chicken(420541) STEAP family member 2, metalloreductase
Horse(100050610) STEAP family member 2, metalloreductase
domestic cat(101080957) STEAP family member 2, metalloreductase
dog(482291) STEAP family member 2, metalloreductase
cow(504616) STEAP family member 2, metalloreductase
sheep(101111960) STEAP family member 2, metalloreductase
Domestic Rabbit(100328631) STEAP family member 2, metalloreductase
naked mole-rat(101701450) STEAP family member 2, metalloreductase
domestic guinea pig(100729189) STEAP family member 2, metalloreductase
253 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152999 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001103156 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001103156 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001103156 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040665 Rosetta Predictions human pricing
NM_001040666 Rosetta Predictions human pricing
NM_152999 Rosetta Predictions human pricing
NM_001107846 Rosetta Predictions rat pricing
NM_001103156 Rosetta Predictions mouse pricing
NM_001103157 Rosetta Predictions mouse pricing
NM_028734 Rosetta Predictions mouse pricing
XM_284053 Rosetta Predictions mouse pricing
XM_892706 Rosetta Predictions mouse pricing
XM_900249 Rosetta Predictions mouse pricing
XM_900284 Rosetta Predictions mouse pricing
XM_900291 Rosetta Predictions mouse pricing
XM_900299 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112474 predicted 1255
2 SASI_Hs01_00112475 predicted 500
3 SASI_Hs01_00112477 predicted 352
4 SASI_Hs01_00112478 predicted 1182
5 SASI_Hs01_00112479 predicted 524
6 SASI_Hs01_00112480 predicted 503
7 SASI_Hs01_00112481 predicted 520
8 SASI_Hs02_00309049 predicted 557
9 SASI_Hs01_00112482 predicted 545
10 SASI_Hs01_00112483 predicted 396
11 SASI_Hs01_00112476 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043959 predicted 1275
2 SASI_Hs01_00043960 predicted 518
3 SASI_Hs01_00043962 predicted 368
4 SASI_Hs01_00043963 predicted 1206
5 SASI_Hs01_00043964 predicted 543
6 SASI_Hs01_00043965 predicted 519
7 SASI_Hs01_00043966 predicted 541
8 SASI_Hs02_00309050 predicted 577
9 SASI_Hs01_00043967 predicted 555
10 SASI_Hs01_00043968 predicted 412
11 SASI_Hs01_00043961 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189338 predicted 1481
2 SASI_Hs01_00189339 predicted 727
3 SASI_Hs01_00189341 predicted 580
4 SASI_Hs01_00189342 predicted 1403
5 SASI_Hs01_00189343 predicted 748
6 SASI_Hs01_00189344 predicted 724
7 SASI_Hs01_00189345 predicted 743
8 SASI_Hs02_00366957 predicted 778
9 SASI_Hs01_00189346 predicted 765
10 SASI_Hs01_00189347 predicted 619
11 SASI_Hs01_00189340 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232855 predicted 1087
2 SASI_Rn02_00232856 predicted 1651
3 SASI_Rn02_00232857 predicted 1536
4 SASI_Rn02_00232858 predicted 1804
5 SASI_Rn02_00232859 predicted 1521
6 SASI_Rn02_00232860 predicted 1147
7 SASI_Rn02_00232861 predicted 552
8 SASI_Rn02_00232862 predicted 1282
9 SASI_Rn02_00232863 predicted 966
10 SASI_Rn02_00232864 predicted 1593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303104 predicted 503
2 SASI_Mm02_00303105 predicted 619
3 SASI_Mm02_00303106 predicted 925
4 SASI_Mm02_00303107 predicted 1775
5 SASI_Mm02_00303108 predicted 996
6 SASI_Mm02_00303109 predicted 1213
7 SASI_Mm02_00303110 predicted 408
8 SASI_Mm02_00303111 predicted 457
9 SASI_Mm02_00303112 predicted 1630
10 SASI_Mm02_00303113 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303114 predicted 862
2 SASI_Mm02_00303115 predicted 975
3 SASI_Mm02_00303116 predicted 1285
4 SASI_Mm02_00303117 predicted 2128
5 SASI_Mm02_00303118 predicted 1346
6 SASI_Mm02_00303119 predicted 1567
7 SASI_Mm02_00303120 predicted 761
8 SASI_Mm02_00303121 predicted 817
9 SASI_Mm02_00303122 predicted 1983
10 SASI_Mm02_00303123 predicted 1787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334300 predicted 575
2 SASI_Mm02_00334301 predicted 688
3 SASI_Mm02_00334302 predicted 992
4 SASI_Mm02_00334303 predicted 1841
5 SASI_Mm02_00334304 predicted 1065
6 SASI_Mm02_00334305 predicted 1277
7 SASI_Mm02_00334306 predicted 471
8 SASI_Mm02_00334307 predicted 528
9 SASI_Mm02_00334308 predicted 1695
10 SASI_Mm02_00334309 predicted 1506
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276840 predicted 842
2 SASI_Mm01_00276841 predicted 959
3 SASI_Mm01_00276842 predicted 1260
4 SASI_Mm01_00276843 predicted 2110
5 SASI_Mm01_00276844 predicted 1329
6 SASI_Mm01_00276845 predicted 746
7 SASI_Mm01_00276846 predicted 794
8 SASI_Mm01_00276847 predicted 1958
9 SASI_Mm01_00276848 predicted 1301
10 SASI_Mm01_00276849 predicted 1775
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_892706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271748 predicted 521
2 SASI_Mm01_00271749 predicted 636
3 SASI_Mm01_00271750 predicted 948
4 SASI_Mm01_00271751 predicted 1797
5 SASI_Mm01_00271752 predicted 1016
6 SASI_Mm01_00271753 predicted 425
7 SASI_Mm01_00271754 predicted 477
8 SASI_Mm01_00271755 predicted 1648
9 SASI_Mm01_00271756 predicted 976
10 SASI_Mm01_00271757 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900249 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254524 predicted 585
2 SASI_Mm01_00254525 predicted 701
3 SASI_Mm01_00254526 predicted 1007
4 SASI_Mm01_00254527 predicted 545
5 SASI_Mm01_00254528 predicted 1082
6 SASI_Mm01_00254529 predicted 386
7 SASI_Mm01_00254530 predicted 493
8 SASI_Mm01_00254531 predicted 1047
9 SASI_Mm01_00254532 predicted 1063
10 SASI_Mm01_00254533 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900284 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232981 predicted 591
2 SASI_Mm01_00232982 predicted 707
3 SASI_Mm01_00232983 predicted 1011
4 SASI_Mm01_00232984 predicted 1851
5 SASI_Mm01_00232985 predicted 1076
6 SASI_Mm01_00232986 predicted 486
7 SASI_Mm01_00232987 predicted 541
8 SASI_Mm01_00232988 predicted 1713
9 SASI_Mm01_00232989 predicted 1049
10 SASI_Mm01_00232990 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208394 predicted 370
2 SASI_Mm01_00208395 predicted 485
3 SASI_Mm01_00208396 predicted 784
4 SASI_Mm01_00208397 predicted 856
5 SASI_Mm01_00208398 predicted 270
6 SASI_Mm01_00208399 predicted 316
7 SASI_Mm01_00208400 predicted 825
8 SASI_Mm01_00208401 predicted 1297
9 SASI_Mm01_00208402 predicted 1289
10 SASI_Mm01_00208403 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900299 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243597 predicted 357
2 SASI_Mm01_00243598 predicted 469
3 SASI_Mm01_00243599 predicted 783
4 SASI_Mm01_00243600 predicted 1623
5 SASI_Mm01_00243601 predicted 842
6 SASI_Mm01_00243602 predicted 255
7 SASI_Mm01_00243603 predicted 317
8 SASI_Mm01_00243604 predicted 1478
9 SASI_Mm01_00243605 predicted 813
10 SASI_Mm01_00243606 predicted 1286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152999
VALIDATED
STEAP2 MISSION shRNA Bacterial Glycerol Stock
STEAP family member 2, metalloreductase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_152999.3-1035s21c1
Sequence:CCGGGCCAGTGGTGGTAGCTATAAGCTCGAGCTTATAGCTACCACCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152999.3-1877s21c1
Sequence:CCGGTGTTCACAGCTGCCATATAAACTCGAGTTTATATGGCAGCTGTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_152999.3-913s21c1
Sequence:CCGGGCGCGACAACAGGTTATTGAACTCGAGTTCAATAACCTGTTGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_152999.3-452s21c1
Sequence:CCGGATGGCATAAATGGTATCAAAGCTCGAGCTTTGATACCATTTATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_152999.3-1471s21c1
Sequence:CCGGTATATCTCCTTTGGCATAATGCTCGAGCATTATGCCAAAGGAGATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152999.2-535s1c1
Sequence:CCGGCGACTTATTAGATGCGGCTATCTCGAGATAGCCGCATCTAATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152999.2-1245s1c1
Sequence:CCGGCGGCACCAAGTATAGGAGATTCTCGAGAATCTCCTATACTTGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152999.2-913s1c1
Sequence:CCGGGCGCGACAACAGGTTATTGAACTCGAGTTCAATAACCTGTTGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152999.2-1709s1c1
Sequence:CCGGCCTCAATTGTAATTCTGGGTACTCGAGTACCCAGAATTACAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152999.2-805s1c1
Sequence:CCGGCCAGATTCTTTGATTGTCAAACTCGAGTTTGACAATCAAAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152999
VALIDATED
STEAP2 MISSION shRNA shRNA Plasmid DNA
STEAP family member 2, metalloreductase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_152999.3-1035s21c1
Sequence:CCGGGCCAGTGGTGGTAGCTATAAGCTCGAGCTTATAGCTACCACCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152999.3-1877s21c1
Sequence:CCGGTGTTCACAGCTGCCATATAAACTCGAGTTTATATGGCAGCTGTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_152999.3-913s21c1
Sequence:CCGGGCGCGACAACAGGTTATTGAACTCGAGTTCAATAACCTGTTGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_152999.3-452s21c1
Sequence:CCGGATGGCATAAATGGTATCAAAGCTCGAGCTTTGATACCATTTATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_152999.3-1471s21c1
Sequence:CCGGTATATCTCCTTTGGCATAATGCTCGAGCATTATGCCAAAGGAGATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152999.2-535s1c1
Sequence:CCGGCGACTTATTAGATGCGGCTATCTCGAGATAGCCGCATCTAATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152999.2-1245s1c1
Sequence:CCGGCGGCACCAAGTATAGGAGATTCTCGAGAATCTCCTATACTTGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152999.2-913s1c1
Sequence:CCGGGCGCGACAACAGGTTATTGAACTCGAGTTCAATAACCTGTTGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152999.2-1709s1c1
Sequence:CCGGCCTCAATTGTAATTCTGGGTACTCGAGTACCCAGAATTACAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152999.2-805s1c1
Sequence:CCGGCCAGATTCTTTGATTGTCAAACTCGAGTTTGACAATCAAAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152999
VALIDATED
STEAP2 MISSION shRNA Lentiviral Transduction Particles
STEAP family member 2, metalloreductase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_152999.3-1035s21c1
Sequence:CCGGGCCAGTGGTGGTAGCTATAAGCTCGAGCTTATAGCTACCACCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152999.3-1877s21c1
Sequence:CCGGTGTTCACAGCTGCCATATAAACTCGAGTTTATATGGCAGCTGTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_152999.3-913s21c1
Sequence:CCGGGCGCGACAACAGGTTATTGAACTCGAGTTCAATAACCTGTTGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_152999.3-452s21c1
Sequence:CCGGATGGCATAAATGGTATCAAAGCTCGAGCTTTGATACCATTTATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_152999.3-1471s21c1
Sequence:CCGGTATATCTCCTTTGGCATAATGCTCGAGCATTATGCCAAAGGAGATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152999.2-535s1c1
Sequence:CCGGCGACTTATTAGATGCGGCTATCTCGAGATAGCCGCATCTAATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152999.2-1245s1c1
Sequence:CCGGCGGCACCAAGTATAGGAGATTCTCGAGAATCTCCTATACTTGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_152999.2-913s1c1
Sequence:CCGGGCGCGACAACAGGTTATTGAACTCGAGTTCAATAACCTGTTGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152999.2-1709s1c1
Sequence:CCGGCCTCAATTGTAATTCTGGGTACTCGAGTACCCAGAATTACAATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152999.2-805s1c1
Sequence:CCGGCCAGATTCTTTGATTGTCAAACTCGAGTTTGACAATCAAAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001103156
VALIDATED
STEAP2 MISSION shRNA Bacterial Glycerol Stock
STEAP family member 2, metalloreductase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001103156.1-1130s21c1
Sequence:CCGGGCACTAAGTACCGCCGATTTCCTCGAGGAAATCGGCGGTACTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103156.1-1490s21c1
Sequence:CCGGTCACGACCTTCCACGTGTTAACTCGAGTTAACACGTGGAAGGTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001103156.1-335s21c1
Sequence:CCGGATGGCATAAATGGTATCAAAGCTCGAGCTTTGATACCATTTATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001103156.1-9226s21c1
Sequence:CCGGTCTCGCGTTTCTCTATTATTACTCGAGTAATAATAGAGAAACGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001103156.1-407s21c1
Sequence:CCGGCTCTGACCATTCGGCTTATTACTCGAGTAATAAGCCGAATGGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001103156
VALIDATED
STEAP2 MISSION shRNA shRNA Plasmid DNA
STEAP family member 2, metalloreductase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001103156.1-1130s21c1
Sequence:CCGGGCACTAAGTACCGCCGATTTCCTCGAGGAAATCGGCGGTACTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103156.1-1490s21c1
Sequence:CCGGTCACGACCTTCCACGTGTTAACTCGAGTTAACACGTGGAAGGTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001103156.1-335s21c1
Sequence:CCGGATGGCATAAATGGTATCAAAGCTCGAGCTTTGATACCATTTATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001103156.1-9226s21c1
Sequence:CCGGTCTCGCGTTTCTCTATTATTACTCGAGTAATAATAGAGAAACGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001103156.1-407s21c1
Sequence:CCGGCTCTGACCATTCGGCTTATTACTCGAGTAATAAGCCGAATGGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001103156
VALIDATED
STEAP2 MISSION shRNA Lentiviral Transduction Particles
STEAP family member 2, metalloreductase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001103156.1-1130s21c1
Sequence:CCGGGCACTAAGTACCGCCGATTTCCTCGAGGAAATCGGCGGTACTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103156.1-1490s21c1
Sequence:CCGGTCACGACCTTCCACGTGTTAACTCGAGTTAACACGTGGAAGGTCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001103156.1-335s21c1
Sequence:CCGGATGGCATAAATGGTATCAAAGCTCGAGCTTTGATACCATTTATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001103156.1-9226s21c1
Sequence:CCGGTCTCGCGTTTCTCTATTATTACTCGAGTAATAATAGAGAAACGCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001103156.1-407s21c1
Sequence:CCGGCTCTGACCATTCGGCTTATTACTCGAGTAATAAGCCGAATGGTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks