EMAIL THIS PAGE TO A FRIEND

STEAP3

STEAP family member 3, metalloreductase

Synonyms: AHMIO2 STMP3 TSAP6 dudlin-2
Gene ID:
Mouse(68428) STEAP family member 3
Rat(170824) STEAP family member 3, metalloreductase
Zebrafish(100320152) STEAP family member 3, metalloreductase
chicken(424275) STEAP family member 3, metalloreductase
dog(483885) STEAP family member 3, metalloreductase
Horse(100052119) STEAP family member 3, metalloreductase
domestic cat(101083356) STEAP family member 3, metalloreductase
domestic guinea pig(100712964) STEAP family member 3, metalloreductase
naked mole-rat(101706294) STEAP family member 3, metalloreductase
Domestic Rabbit(100354683) STEAP family member 3, metalloreductase
cow(504235) STEAP family member 3, metalloreductase
sheep(101118766) STEAP family member 3, metalloreductase
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018234 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125031 MISSION® esiRNA esiRNA human STEAP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008410 Rosetta Predictions human pricing
NM_018234 Rosetta Predictions human pricing
NM_182915 Rosetta Predictions human pricing
NM_133314 Rosetta Predictions rat pricing
NM_001085409 Rosetta Predictions mouse pricing
NM_133186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094591 predicted 1251
2 SASI_Hs01_00094592 predicted 1035
3 SASI_Hs02_00305458 predicted 815
4 SASI_Hs01_00094594 predicted 1239
5 SASI_Hs01_00094595 predicted 1336
6 SASI_Hs02_00305459 predicted 568
7 SASI_Hs02_00305460 predicted 1211
8 SASI_Hs02_00305461 predicted 761
9 SASI_Hs01_00094596 predicted 984
10 SASI_Hs01_00094597 predicted 766
11 SASI_Hs01_00094590 predicted 414
12 SASI_Hs01_00094593 predicted 401
13 SASI_Hs01_00094598 predicted 1076
14 SASI_Hs01_00094599 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137965 predicted 1319
2 SASI_Hs01_00137966 predicted 1104
3 SASI_Hs02_00351569 predicted 876
4 SASI_Hs01_00137968 predicted 1301
5 SASI_Hs01_00137969 predicted 1400
6 SASI_Hs02_00351570 predicted 636
7 SASI_Hs02_00351571 predicted 1286
8 SASI_Hs02_00351572 predicted 822
9 SASI_Hs01_00137970 predicted 1059
10 SASI_Hs01_00137971 predicted 836
11 SASI_Hs01_00137964 predicted 475
12 SASI_Hs01_00137967 predicted 460
13 SASI_Hs01_00137972 predicted 1144
14 SASI_Hs01_00137973 predicted 1295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050235 predicted 1660
2 SASI_Hs01_00050236 predicted 1449
3 SASI_Hs02_00371024 predicted 1223
4 SASI_Hs01_00050238 predicted 1651
5 SASI_Hs01_00050239 predicted 1752
6 SASI_Hs02_00371025 predicted 984
7 SASI_Hs02_00371026 predicted 1625
8 SASI_Hs02_00371027 predicted 1175
9 SASI_Hs01_00050240 predicted 1402
10 SASI_Hs01_00050241 predicted 1177
11 SASI_Hs01_00050234 predicted 824
12 SASI_Hs01_00050237 predicted 811
13 SASI_Hs01_00050242 predicted 1491
14 SASI_Hs01_00050243 predicted 1648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133314 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041547 predicted 288
2 SASI_Rn01_00041548 predicted 341
3 SASI_Rn02_00267619 predicted 263
4 SASI_Rn01_00041549 predicted 1190
5 SASI_Rn01_00041550 predicted 263
6 SASI_Rn01_00041551 predicted 404
7 SASI_Rn01_00041552 predicted 536
8 SASI_Rn01_00041553 predicted 1226
9 SASI_Rn01_00041554 predicted 325
10 SASI_Rn01_00041555 predicted 504
11 SASI_Rn01_00041556 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300345 predicted 1122
2 SASI_Mm02_00300346 predicted 2353
3 SASI_Mm02_00300347 predicted 668
4 SASI_Mm02_00300348 predicted 745
5 SASI_Mm02_00300349 predicted 1577
6 SASI_Mm02_00300350 predicted 1621
7 SASI_Mm02_00300351 predicted 1178
8 SASI_Mm02_00300352 predicted 1149
9 SASI_Mm02_00300353 predicted 1098
10 SASI_Mm02_00300354 predicted 1412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084957 predicted 753
2 SASI_Mm02_00338346 predicted 1979
3 SASI_Mm02_00338347 predicted 294
4 SASI_Mm02_00338348 predicted 373
5 SASI_Mm01_00084958 predicted 1198
6 SASI_Mm02_00338349 predicted 1251
7 SASI_Mm02_00338350 predicted 803
8 SASI_Mm01_00084959 predicted 769
9 SASI_Mm01_00084961 predicted 722
10 SASI_Mm02_00338351 predicted 1044
11 SASI_Mm01_00084954 predicted 373
12 SASI_Mm01_00084955 predicted 1208
13 SASI_Mm01_00084956 predicted 1672
14 SASI_Mm01_00084960 predicted 1636
15 SASI_Mm01_00084962 predicted 708
16 SASI_Mm01_00084963 predicted 736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018234
STEAP3 MISSION shRNA Bacterial Glycerol Stock
STEAP family member 3, metalloreductase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018234.1-3250s1c1
Sequence:CCGGCGGCAGAAACTTGTCTCATAACTCGAGTTATGAGACAAGTTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018234.1-182s1c1
Sequence:CCGGCAGCGATAGTAGCCTTGCCAACTCGAGTTGGCAAGGCTACTATCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018234.1-803s1c1
Sequence:CCGGCGTCTGCTTCTATGCCTACAACTCGAGTTGTAGGCATAGAAGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018234.1-501s1c1
Sequence:CCGGCTTCAGCATCGTGAGTCCAATCTCGAGATTGGACTCACGATGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018234.1-1274s1c1
Sequence:CCGGGTCCATTGCAAACTCGCTCAACTCGAGTTGAGCGAGTTTGCAATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018234.2-524s21c1
Sequence:CCGGCTTCAGCATCGTGAGTCCAATCTCGAGATTGGACTCACGATGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018234.2-1297s21c1
Sequence:CCGGGTCCATTGCAAACTCGCTCAACTCGAGTTGAGCGAGTTTGCAATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018234.2-3273s21c1
Sequence:CCGGCGGCAGAAACTTGTCTCATAACTCGAGTTATGAGACAAGTTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018234.2-205s21c1
Sequence:CCGGCAGCGATAGTAGCCTTGCCAACTCGAGTTGGCAAGGCTACTATCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018234.2-826s21c1
Sequence:CCGGCGTCTGCTTCTATGCCTACAACTCGAGTTGTAGGCATAGAAGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018234
STEAP3 MISSION shRNA shRNA Plasmid DNA
STEAP family member 3, metalloreductase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018234.1-3250s1c1
Sequence:CCGGCGGCAGAAACTTGTCTCATAACTCGAGTTATGAGACAAGTTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018234.1-182s1c1
Sequence:CCGGCAGCGATAGTAGCCTTGCCAACTCGAGTTGGCAAGGCTACTATCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018234.1-803s1c1
Sequence:CCGGCGTCTGCTTCTATGCCTACAACTCGAGTTGTAGGCATAGAAGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018234.1-501s1c1
Sequence:CCGGCTTCAGCATCGTGAGTCCAATCTCGAGATTGGACTCACGATGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018234.1-1274s1c1
Sequence:CCGGGTCCATTGCAAACTCGCTCAACTCGAGTTGAGCGAGTTTGCAATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018234.2-524s21c1
Sequence:CCGGCTTCAGCATCGTGAGTCCAATCTCGAGATTGGACTCACGATGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018234.2-1297s21c1
Sequence:CCGGGTCCATTGCAAACTCGCTCAACTCGAGTTGAGCGAGTTTGCAATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018234.2-3273s21c1
Sequence:CCGGCGGCAGAAACTTGTCTCATAACTCGAGTTATGAGACAAGTTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018234.2-205s21c1
Sequence:CCGGCAGCGATAGTAGCCTTGCCAACTCGAGTTGGCAAGGCTACTATCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018234.2-826s21c1
Sequence:CCGGCGTCTGCTTCTATGCCTACAACTCGAGTTGTAGGCATAGAAGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018234
STEAP3 MISSION shRNA Lentiviral Transduction Particles
STEAP family member 3, metalloreductase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064643    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018234.1-3250s1c1
Sequence:CCGGCGGCAGAAACTTGTCTCATAACTCGAGTTATGAGACAAGTTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018234.1-182s1c1
Sequence:CCGGCAGCGATAGTAGCCTTGCCAACTCGAGTTGGCAAGGCTACTATCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018234.1-803s1c1
Sequence:CCGGCGTCTGCTTCTATGCCTACAACTCGAGTTGTAGGCATAGAAGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018234.1-501s1c1
Sequence:CCGGCTTCAGCATCGTGAGTCCAATCTCGAGATTGGACTCACGATGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018234.1-1274s1c1
Sequence:CCGGGTCCATTGCAAACTCGCTCAACTCGAGTTGAGCGAGTTTGCAATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018234.2-524s21c1
Sequence:CCGGCTTCAGCATCGTGAGTCCAATCTCGAGATTGGACTCACGATGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018234.2-1297s21c1
Sequence:CCGGGTCCATTGCAAACTCGCTCAACTCGAGTTGAGCGAGTTTGCAATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018234.2-3273s21c1
Sequence:CCGGCGGCAGAAACTTGTCTCATAACTCGAGTTATGAGACAAGTTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018234.2-205s21c1
Sequence:CCGGCAGCGATAGTAGCCTTGCCAACTCGAGTTGGCAAGGCTACTATCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018234.2-826s21c1
Sequence:CCGGCGTCTGCTTCTATGCCTACAACTCGAGTTGTAGGCATAGAAGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133186
VALIDATED
STEAP3 MISSION shRNA Bacterial Glycerol Stock
STEAP family member 3, metalloreductase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133186.1-756s1c1
Sequence:CCGGGCCATACATTCGGAAAGATGACTCGAGTCATCTTTCCGAATGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174731    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133186.1-1768s1c1
Sequence:CCGGGTAACGCATTTCAAACGCAAACTCGAGTTTGCGTTTGAAATGCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193198    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133186.1-1724s1c1
Sequence:CCGGCTTAGGCTAAACAACACACAACTCGAGTTGTGTGTTGTTTAGCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133186.3-381s21c1
Sequence:CCGGCAAGATCCTCGTGGATGTAAGCTCGAGCTTACATCCACGAGGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133186.3-449s21c1
Sequence:CCGGAGTACCTGGCCTCACTCTTTCCTCGAGGAAAGAGTGAGGCCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133186.3-1190s21c1
Sequence:CCGGCGCTCCCGTCCATTGCTAATTCTCGAGAATTAGCAATGGACGGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133186.3-1421s21c1
Sequence:CCGGACCGCAGACTCACCAAGATACCTCGAGGTATCTTGGTGAGTCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133186.3-1592s21c1
Sequence:CCGGACAGCGAGGTGATGATATATGCTCGAGCATATATCATCACCTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133186
VALIDATED
STEAP3 MISSION shRNA shRNA Plasmid DNA
STEAP family member 3, metalloreductase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133186.1-756s1c1
Sequence:CCGGGCCATACATTCGGAAAGATGACTCGAGTCATCTTTCCGAATGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174731    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133186.1-1768s1c1
Sequence:CCGGGTAACGCATTTCAAACGCAAACTCGAGTTTGCGTTTGAAATGCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193198    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133186.1-1724s1c1
Sequence:CCGGCTTAGGCTAAACAACACACAACTCGAGTTGTGTGTTGTTTAGCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133186.3-381s21c1
Sequence:CCGGCAAGATCCTCGTGGATGTAAGCTCGAGCTTACATCCACGAGGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133186.3-449s21c1
Sequence:CCGGAGTACCTGGCCTCACTCTTTCCTCGAGGAAAGAGTGAGGCCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133186.3-1190s21c1
Sequence:CCGGCGCTCCCGTCCATTGCTAATTCTCGAGAATTAGCAATGGACGGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133186.3-1421s21c1
Sequence:CCGGACCGCAGACTCACCAAGATACCTCGAGGTATCTTGGTGAGTCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133186.3-1592s21c1
Sequence:CCGGACAGCGAGGTGATGATATATGCTCGAGCATATATCATCACCTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133186
VALIDATED
STEAP3 MISSION shRNA Lentiviral Transduction Particles
STEAP family member 3, metalloreductase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133186.1-756s1c1
Sequence:CCGGGCCATACATTCGGAAAGATGACTCGAGTCATCTTTCCGAATGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174731    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133186.1-1768s1c1
Sequence:CCGGGTAACGCATTTCAAACGCAAACTCGAGTTTGCGTTTGAAATGCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193198    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133186.1-1724s1c1
Sequence:CCGGCTTAGGCTAAACAACACACAACTCGAGTTGTGTGTTGTTTAGCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133186.3-381s21c1
Sequence:CCGGCAAGATCCTCGTGGATGTAAGCTCGAGCTTACATCCACGAGGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133186.3-449s21c1
Sequence:CCGGAGTACCTGGCCTCACTCTTTCCTCGAGGAAAGAGTGAGGCCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133186.3-1190s21c1
Sequence:CCGGCGCTCCCGTCCATTGCTAATTCTCGAGAATTAGCAATGGACGGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133186.3-1421s21c1
Sequence:CCGGACCGCAGACTCACCAAGATACCTCGAGGTATCTTGGTGAGTCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133186.3-1592s21c1
Sequence:CCGGACAGCGAGGTGATGATATATGCTCGAGCATATATCATCACCTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks