EMAIL THIS PAGE TO A FRIEND

STEAP4

STEAP family member 4

Synonyms: STAMP2 TIARP TNFAIP9
UniProtKB ID: Q687X5, Q658Q9, Q687X4, Q8WWB0, Q9H5R1
Gene ID:
Human(79689) Summary: The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
Mouse(117167) STEAP family member 4
Rat(499991) STEAP family member 4
Zebrafish(550429) STEAP family member 4
chicken(772063) STEAP family member 4
dog(482287) STEAP family member 4
Horse(100059718) STEAP family member 4
domestic cat(101101204) STEAP family member 4
cow(538861) STEAP family member 4
sheep(101111187) STEAP family member 4
Domestic Rabbit(100353852) STEAP family member 4
naked mole-rat(101704516) STEAP family member 4
domestic guinea pig(100735486) STEAP family member 4
131 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024636 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_054098 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054098 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054098 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024636 Rosetta Predictions human pricing
NM_001044265 Rosetta Predictions rat pricing
NM_054098 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105515 predicted 769
2 SASI_Hs01_00105516 predicted 1405
3 SASI_Hs01_00105517 predicted 457
4 SASI_Hs02_00357018 predicted 1514
5 SASI_Hs01_00105519 predicted 1395
6 SASI_Hs01_00105520 predicted 584
7 SASI_Hs01_00105521 predicted 1052
8 SASI_Hs01_00105522 predicted 1024
9 SASI_Hs01_00105523 predicted 679
10 SASI_Hs01_00105524 predicted 849
11 SASI_Hs01_00105518 predicted 1327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205324 predicted 479
2 SASI_Rn02_00205325 predicted 1285
3 SASI_Rn02_00205326 predicted 1589
4 SASI_Rn02_00205327 predicted 871
5 SASI_Rn02_00205328 predicted 1050
6 SASI_Rn02_00205329 predicted 406
7 SASI_Rn02_00205330 predicted 777
8 SASI_Rn02_00205331 predicted 1111
9 SASI_Rn02_00205332 predicted 396
10 SASI_Rn02_00205333 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054098 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182630 predicted 961
2 SASI_Mm01_00182631 predicted 1489
3 SASI_Mm01_00182632 predicted 1054
4 SASI_Mm01_00182633 predicted 1083
5 SASI_Mm01_00182634 predicted 1226
6 SASI_Mm01_00182635 predicted 816
7 SASI_Mm01_00182636 predicted 1513
8 SASI_Mm01_00182637 predicted 993
9 SASI_Mm01_00182638 predicted 565
10 SASI_Mm01_00182639 predicted 1029
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024636
STEAP4 MISSION shRNA Bacterial Glycerol Stock
STEAP family member 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000415859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024636.2-1033s21c1
Sequence:CCGGGTGATTCCTATTCGATATTATCTCGAGATAATATCGAATAGGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024636.1-556s1c1
Sequence:CCGGGCAGGTGTTTGTGTGTGGAAACTCGAGTTTCCACACACAAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024636.1-841s1c1
Sequence:CCGGCTTTCCAATAACAGCACCTTACTCGAGTAAGGTGCTGTTATTGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024636.1-588s1c1
Sequence:CCGGCCAAGCAAAGAGTGATGGATACTCGAGTATCCATCACTCTTTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024636.1-688s1c1
Sequence:CCGGGCTATTTCCAATGTGGAGGTTCTCGAGAACCTCCACATTGGAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024636.1-315s1c1
Sequence:CCGGCCAAGAAGTCTGACATCATAACTCGAGTTATGATGTCAGACTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024636
STEAP4 MISSION shRNA shRNA Plasmid DNA
STEAP family member 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000415859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024636.2-1033s21c1
Sequence:CCGGGTGATTCCTATTCGATATTATCTCGAGATAATATCGAATAGGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024636.1-556s1c1
Sequence:CCGGGCAGGTGTTTGTGTGTGGAAACTCGAGTTTCCACACACAAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024636.1-841s1c1
Sequence:CCGGCTTTCCAATAACAGCACCTTACTCGAGTAAGGTGCTGTTATTGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024636.1-588s1c1
Sequence:CCGGCCAAGCAAAGAGTGATGGATACTCGAGTATCCATCACTCTTTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024636.1-688s1c1
Sequence:CCGGGCTATTTCCAATGTGGAGGTTCTCGAGAACCTCCACATTGGAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024636.1-315s1c1
Sequence:CCGGCCAAGAAGTCTGACATCATAACTCGAGTTATGATGTCAGACTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024636
STEAP4 MISSION shRNA Lentiviral Transduction Particles
STEAP family member 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000415859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024636.2-1033s21c1
Sequence:CCGGGTGATTCCTATTCGATATTATCTCGAGATAATATCGAATAGGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024636.1-556s1c1
Sequence:CCGGGCAGGTGTTTGTGTGTGGAAACTCGAGTTTCCACACACAAACACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024636.1-841s1c1
Sequence:CCGGCTTTCCAATAACAGCACCTTACTCGAGTAAGGTGCTGTTATTGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024636.1-588s1c1
Sequence:CCGGCCAAGCAAAGAGTGATGGATACTCGAGTATCCATCACTCTTTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024636.1-688s1c1
Sequence:CCGGGCTATTTCCAATGTGGAGGTTCTCGAGAACCTCCACATTGGAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024636.1-315s1c1
Sequence:CCGGCCAAGAAGTCTGACATCATAACTCGAGTTATGATGTCAGACTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054098
STEAP4 MISSION shRNA Bacterial Glycerol Stock
STEAP family member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054098.3-1314s21c1
Sequence:CCGGGAGCCTCCCTTCGGCTTATATCTCGAGATATAAGCCGAAGGGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054098.3-370s1c1
Sequence:CCGGGTATTGGTAGACGTCAGTAACCTCGAGGTTACTGACGTCTACCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_054098.3-2407s1c1
Sequence:CCGGGCTAGTAAGCTACGCAAATACCTCGAGGTATTTGCGTAGCTTACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054098.3-1048s21c1
Sequence:CCGGATTACTCAGGCCCTAACTAATCTCGAGATTAGTTAGGGCCTGAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054098.3-370s21c1
Sequence:CCGGGTATTGGTAGACGTCAGTAACCTCGAGGTTACTGACGTCTACCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054098.3-2406s21c1
Sequence:CCGGAGCTAGTAAGCTACGCAAATACTCGAGTATTTGCGTAGCTTACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054098.3-726s21c1
Sequence:CCGGTGCAATACGAGAGGTGATATACTCGAGTATATCACCTCTCGTATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054098.2-336s1c1
Sequence:CCGGCCTCACGGAACTAGTTGATTACTCGAGTAATCAACTAGTTCCGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054098.2-725s1c1
Sequence:CCGGGTGCAATACGAGAGGTGATATCTCGAGATATCACCTCTCGTATTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054098.2-1216s1c1
Sequence:CCGGGTTCAGTCCAAACTGGGTTATCTCGAGATAACCCAGTTTGGACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054098
STEAP4 MISSION shRNA shRNA Plasmid DNA
STEAP family member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054098.3-1314s21c1
Sequence:CCGGGAGCCTCCCTTCGGCTTATATCTCGAGATATAAGCCGAAGGGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054098.3-370s1c1
Sequence:CCGGGTATTGGTAGACGTCAGTAACCTCGAGGTTACTGACGTCTACCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_054098.3-2407s1c1
Sequence:CCGGGCTAGTAAGCTACGCAAATACCTCGAGGTATTTGCGTAGCTTACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054098.3-1048s21c1
Sequence:CCGGATTACTCAGGCCCTAACTAATCTCGAGATTAGTTAGGGCCTGAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054098.3-370s21c1
Sequence:CCGGGTATTGGTAGACGTCAGTAACCTCGAGGTTACTGACGTCTACCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054098.3-2406s21c1
Sequence:CCGGAGCTAGTAAGCTACGCAAATACTCGAGTATTTGCGTAGCTTACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054098.3-726s21c1
Sequence:CCGGTGCAATACGAGAGGTGATATACTCGAGTATATCACCTCTCGTATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054098.2-336s1c1
Sequence:CCGGCCTCACGGAACTAGTTGATTACTCGAGTAATCAACTAGTTCCGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054098.2-725s1c1
Sequence:CCGGGTGCAATACGAGAGGTGATATCTCGAGATATCACCTCTCGTATTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054098.2-1216s1c1
Sequence:CCGGGTTCAGTCCAAACTGGGTTATCTCGAGATAACCCAGTTTGGACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054098
STEAP4 MISSION shRNA Lentiviral Transduction Particles
STEAP family member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054098.3-1314s21c1
Sequence:CCGGGAGCCTCCCTTCGGCTTATATCTCGAGATATAAGCCGAAGGGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054098.3-370s1c1
Sequence:CCGGGTATTGGTAGACGTCAGTAACCTCGAGGTTACTGACGTCTACCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217701    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_054098.3-2407s1c1
Sequence:CCGGGCTAGTAAGCTACGCAAATACCTCGAGGTATTTGCGTAGCTTACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054098.3-1048s21c1
Sequence:CCGGATTACTCAGGCCCTAACTAATCTCGAGATTAGTTAGGGCCTGAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054098.3-370s21c1
Sequence:CCGGGTATTGGTAGACGTCAGTAACCTCGAGGTTACTGACGTCTACCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054098.3-2406s21c1
Sequence:CCGGAGCTAGTAAGCTACGCAAATACTCGAGTATTTGCGTAGCTTACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054098.3-726s21c1
Sequence:CCGGTGCAATACGAGAGGTGATATACTCGAGTATATCACCTCTCGTATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054098.2-336s1c1
Sequence:CCGGCCTCACGGAACTAGTTGATTACTCGAGTAATCAACTAGTTCCGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054098.2-725s1c1
Sequence:CCGGGTGCAATACGAGAGGTGATATCTCGAGATATCACCTCTCGTATTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054098.2-1216s1c1
Sequence:CCGGGTTCAGTCCAAACTGGGTTATCTCGAGATAACCCAGTTTGGACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks