EMAIL THIS PAGE TO A FRIEND

STGC3

Species: Human STGC3(474171)
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001006608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006608 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017950 Rosetta Predictions human pricing
XR_041447 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495037 predicted 510
2 SASI_Hs02_00495038 predicted 468
3 SASI_Hs02_00495039 predicted 206
4 SASI_Hs02_00495040 predicted 517
5 SASI_Hs02_00495041 predicted 503
6 SASI_Hs02_00495042 predicted 197
7 SASI_Hs02_00495043 predicted 473
8 SASI_Hs02_00495044 predicted 357
9 SASI_Hs02_00495045 predicted 201
10 SASI_Hs02_00495046 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527459 predicted 512
2 SASI_Hs02_00527460 predicted 474
3 SASI_Hs02_00527461 predicted 207
4 SASI_Hs02_00527462 predicted 523
5 SASI_Hs02_00527463 predicted 504
6 SASI_Hs02_00527464 predicted 195
7 SASI_Hs02_00527465 predicted 468
8 SASI_Hs02_00527466 predicted 351
9 SASI_Hs02_00527467 predicted 205
10 SASI_Hs02_00527468 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006608
STGC3 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000167396    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006608.1-1004s1c1
Sequence:CCGGGAGTTGAGATTCCATTAGTATCTCGAGATACTAATGGAATCTCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006608.1-1036s1c1
Sequence:CCGGCTTCTTATTGAGAACTCTGTTCTCGAGAACAGAGTTCTCAATAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006608
STGC3 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000167396    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006608.1-1004s1c1
Sequence:CCGGGAGTTGAGATTCCATTAGTATCTCGAGATACTAATGGAATCTCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006608.1-1036s1c1
Sequence:CCGGCTTCTTATTGAGAACTCTGTTCTCGAGAACAGAGTTCTCAATAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006608
STGC3 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000167396    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006608.1-1004s1c1
Sequence:CCGGGAGTTGAGATTCCATTAGTATCTCGAGATACTAATGGAATCTCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167199    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006608.1-1036s1c1
Sequence:CCGGCTTCTTATTGAGAACTCTGTTCTCGAGAACAGAGTTCTCAATAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks