EMAIL THIS PAGE TO A FRIEND

STH

saitohin

Synonyms: MAPTIT
Species: Human STH(246744), fruit fly sth(252728), Thale Cress STH(817696)
UniProtKB ID: Q8IWL8, A1L3X7
Gene ID:
fruit fly(252728) small thin
Thale Cress(817696) Salt tolerance-like protein
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107758 Anti-STH antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007532 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007532 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007532 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007532 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060884 predicted 206
2 SASI_Hs02_00305322 predicted 210
3 SASI_Hs01_00060879 predicted 195
4 SASI_Hs02_00305323 predicted 163
5 SASI_Hs01_00060880 predicted 234
6 SASI_Hs01_00060881 predicted 238
7 SASI_Hs01_00060883 predicted 168
8 SASI_Hs01_00060885 predicted 249
9 SASI_Hs01_00060886 predicted 132
10 SASI_Hs01_00060888 predicted 292
11 SASI_Hs01_00060882 predicted 131
12 SASI_Hs01_00060887 predicted 110
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007532
STH MISSION shRNA Bacterial Glycerol Stock
saitohin
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007532.1-180s1c1
Sequence:CCGGGAGTTCATCTGAGGTTGGCTTCTCGAGAAGCCAACCTCAGATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007532.2-202s21c1
Sequence:CCGGTTGACCCTGAGTTCATCTGAGCTCGAGCTCAGATGAACTCAGGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007532.2-165s21c1
Sequence:CCGGCAGAACCCTCAGCTTAGCATGCTCGAGCATGCTAAGCTGAGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007532.2-230s21c1
Sequence:CCGGTGGAAGGTGTGGGCACCATTTCTCGAGAAATGGTGCCCACACCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007532.2-131s21c1
Sequence:CCGGCTCTGTGTGAGTGGATGATTCCTCGAGGAATCATCCACTCACACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007532.2-253s21c1
Sequence:CCGGCCCAGTTCTTACAGCTCTGAACTCGAGTTCAGAGCTGTAAGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007532
STH MISSION shRNA shRNA Plasmid DNA
saitohin
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007532.1-180s1c1
Sequence:CCGGGAGTTCATCTGAGGTTGGCTTCTCGAGAAGCCAACCTCAGATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007532.2-202s21c1
Sequence:CCGGTTGACCCTGAGTTCATCTGAGCTCGAGCTCAGATGAACTCAGGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007532.2-165s21c1
Sequence:CCGGCAGAACCCTCAGCTTAGCATGCTCGAGCATGCTAAGCTGAGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007532.2-230s21c1
Sequence:CCGGTGGAAGGTGTGGGCACCATTTCTCGAGAAATGGTGCCCACACCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007532.2-131s21c1
Sequence:CCGGCTCTGTGTGAGTGGATGATTCCTCGAGGAATCATCCACTCACACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007532.2-253s21c1
Sequence:CCGGCCCAGTTCTTACAGCTCTGAACTCGAGTTCAGAGCTGTAAGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007532
STH MISSION shRNA Lentiviral Transduction Particles
saitohin
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172882    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007532.1-180s1c1
Sequence:CCGGGAGTTCATCTGAGGTTGGCTTCTCGAGAAGCCAACCTCAGATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007532.2-202s21c1
Sequence:CCGGTTGACCCTGAGTTCATCTGAGCTCGAGCTCAGATGAACTCAGGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007532.2-165s21c1
Sequence:CCGGCAGAACCCTCAGCTTAGCATGCTCGAGCATGCTAAGCTGAGGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007532.2-230s21c1
Sequence:CCGGTGGAAGGTGTGGGCACCATTTCTCGAGAAATGGTGCCCACACCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007532.2-131s21c1
Sequence:CCGGCTCTGTGTGAGTGGATGATTCCTCGAGGAATCATCCACTCACACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007532.2-253s21c1
Sequence:CCGGCCCAGTTCTTACAGCTCTGAACTCGAGTTCAGAGCTGTAAGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks