EMAIL THIS PAGE TO A FRIEND

STIL

SCL/TAL1 interrupting locus

Synonyms: MCPH7 SIL
UniProtKB ID: Q15468, Q5T0C5, Q68CN9
Gene ID:
Human(6491) Summary: This gene encodes a cytoplasmic protein implicated in regulation of the mitotic spindle checkpoint, a regulatory pathway that monitors chromosome segregation during cell division to ensure the proper distribution of chromosomes to daughter cells. The protein is phosphorylated in mitosis and in response to activation of the spindle checkpoint, and disappears when cells transition to G1 phase. It interacts with a mitotic regulator, and its expression is required to efficiently activate the spindle checkpoint. It is proposed to regulate Cdc2 kinase activity during spindle checkpoint arrest. Chromosomal deletions that fuse this gene and the adjacent locus commonly occur in T cell leukemias, and are thought to arise through illegitimate V-(D)-J recombination events. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(20460) Scl/Tal1 interrupting locus
Rat(313506) Scl/Tal1 interrupting locus
fruit fly(36380) stand still
chicken(424621) SCL/TAL1 interrupting locus
dog(610305) SCL/TAL1 interrupting locus
domestic cat(101097659) SCL/TAL1 interrupting locus
Horse(100051410) SCL/TAL1 interrupting locus
Zebrafish(192317) TAL1 (SCL) interrupting locus
cow(510012) SCL/TAL1 interrupting locus
sheep(101106636) SCL/TAL1 interrupting locus
domestic guinea pig(100712956) SCL/TAL1 interrupting locus
naked mole-rat(101704338) SCL/TAL1 interrupting locus
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA046543 Anti-STIL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003035 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069261 MISSION® esiRNA esiRNA human STIL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048166 Rosetta Predictions human pricing
NM_003035 Rosetta Predictions human pricing
XM_001069563 Rosetta Predictions rat pricing
XM_233429 Rosetta Predictions rat pricing
NM_009185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311542 predicted 1204
2 SASI_Hs02_00311543 predicted 832
3 SASI_Hs02_00311544 predicted 2146
4 SASI_Hs02_00311545 predicted 2299
5 SASI_Hs02_00311546 predicted 3625
6 SASI_Hs02_00311547 predicted 2152
7 SASI_Hs02_00311548 predicted 3663
8 SASI_Hs02_00311549 predicted 2365
9 SASI_Hs02_00311550 predicted 3653
10 SASI_Hs02_00311551 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207993 predicted 1205
2 SASI_Hs01_00207995 predicted 833
3 SASI_Hs02_00334940 predicted 2139
4 SASI_Hs01_00207997 predicted 2294
5 SASI_Hs02_00334941 predicted 3627
6 SASI_Hs01_00208000 predicted 2151
7 SASI_Hs02_00334942 predicted 3654
8 SASI_Hs01_00208001 predicted 2367
9 SASI_Hs02_00334943 predicted 3646
10 SASI_Hs01_00208002 predicted 890
11 SASI_Hs01_00207994 predicted 1196
12 SASI_Hs01_00207996 predicted 1061
13 SASI_Hs01_00207998 predicted 2888
14 SASI_Hs01_00207999 predicted 2162
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328482 predicted 956
2 SASI_Rn02_00328483 predicted 1060
3 SASI_Rn02_00328484 predicted 3333
4 SASI_Rn02_00328485 predicted 3974
5 SASI_Rn02_00328486 predicted 2028
6 SASI_Rn02_00328487 predicted 1617
7 SASI_Rn02_00328488 predicted 976
8 SASI_Rn02_00328489 predicted 1048
9 SASI_Rn02_00328490 predicted 3128
10 SASI_Rn02_00328491 predicted 2162
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233429 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387762 predicted 2934
2 SASI_Rn02_00387763 predicted 691
3 SASI_Rn02_00387764 predicted 797
4 SASI_Rn02_00387765 predicted 3060
5 SASI_Rn02_00387766 predicted 1769
6 SASI_Rn02_00387767 predicted 1362
7 SASI_Rn02_00387768 predicted 713
8 SASI_Rn02_00387769 predicted 784
9 SASI_Rn02_00387770 predicted 2774
10 SASI_Rn02_00387771 predicted 1900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050093 predicted 4128
2 SASI_Mm01_00050094 predicted 907
3 SASI_Mm01_00050095 predicted 2032
4 SASI_Mm02_00315554 predicted 2357
5 SASI_Mm01_00050097 predicted 1717
6 SASI_Mm01_00050098 predicted 2449
7 SASI_Mm01_00050099 predicted 2749
8 SASI_Mm01_00050100 predicted 4152
9 SASI_Mm01_00050101 predicted 3226
10 SASI_Mm01_00050102 predicted 2468
11 SASI_Mm01_00050096 predicted 2000
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003035
VALIDATED
STIL MISSION shRNA Bacterial Glycerol Stock
SCL/TAL1 interrupting locus
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-830s21c1
Sequence:CCGGTCAAGTTCAAGGGACTTATAACTCGAGTTATAAGTCCCTTGAACTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-3527s21c1
Sequence:CCGGGAGATATGGACTCCTACAAAGCTCGAGCTTTGTAGGAGTCCATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-3431s21c1
Sequence:CCGGATTCAGCCTTCTCCATATTAACTCGAGTTAATATGGAGAAGGCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-3923s21c1
Sequence:CCGGGCAACCTTCTGAAACGCTAAACTCGAGTTTAGCGTTTCAGAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-3589s21c1
Sequence:CCGGCAGATAGCAAGAGTGAATATTCTCGAGAATATTCACTCTTGCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-867s21c1
Sequence:CCGGATGGATGAAACACGCAAATTGCTCGAGCAATTTGCGTGTTTCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003035.x-4474s1c1
Sequence:CCGGGATCAGTTATTCCTACAAGTTCTCGAGAACTTGTAGGAATAACTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003035.x-1933s1c1
Sequence:CCGGCCAGGAACAGTATTAAACCATCTCGAGATGGTTTAATACTGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003035.x-1172s1c1
Sequence:CCGGGTCTGGAATTACACATATCTACTCGAGTAGATATGTGTAATTCCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003035.x-3494s1c1
Sequence:CCGGTGGATTAAACTGCATGTCATTCTCGAGAATGACATGCAGTTTAATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003035.x-1740s1c1
Sequence:CCGGCCTTTGATTAACCACTTGGAACTCGAGTTCCAAGTGGTTAATCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003035
VALIDATED
STIL MISSION shRNA shRNA Plasmid DNA
SCL/TAL1 interrupting locus
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-830s21c1
Sequence:CCGGTCAAGTTCAAGGGACTTATAACTCGAGTTATAAGTCCCTTGAACTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-3527s21c1
Sequence:CCGGGAGATATGGACTCCTACAAAGCTCGAGCTTTGTAGGAGTCCATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-3431s21c1
Sequence:CCGGATTCAGCCTTCTCCATATTAACTCGAGTTAATATGGAGAAGGCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-3923s21c1
Sequence:CCGGGCAACCTTCTGAAACGCTAAACTCGAGTTTAGCGTTTCAGAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-3589s21c1
Sequence:CCGGCAGATAGCAAGAGTGAATATTCTCGAGAATATTCACTCTTGCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-867s21c1
Sequence:CCGGATGGATGAAACACGCAAATTGCTCGAGCAATTTGCGTGTTTCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003035.x-4474s1c1
Sequence:CCGGGATCAGTTATTCCTACAAGTTCTCGAGAACTTGTAGGAATAACTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003035.x-1933s1c1
Sequence:CCGGCCAGGAACAGTATTAAACCATCTCGAGATGGTTTAATACTGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003035.x-1172s1c1
Sequence:CCGGGTCTGGAATTACACATATCTACTCGAGTAGATATGTGTAATTCCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003035.x-3494s1c1
Sequence:CCGGTGGATTAAACTGCATGTCATTCTCGAGAATGACATGCAGTTTAATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003035.x-1740s1c1
Sequence:CCGGCCTTTGATTAACCACTTGGAACTCGAGTTCCAAGTGGTTAATCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003035
VALIDATED
STIL MISSION shRNA Lentiviral Transduction Particles
SCL/TAL1 interrupting locus
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-830s21c1
Sequence:CCGGTCAAGTTCAAGGGACTTATAACTCGAGTTATAAGTCCCTTGAACTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-3527s21c1
Sequence:CCGGGAGATATGGACTCCTACAAAGCTCGAGCTTTGTAGGAGTCCATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-3431s21c1
Sequence:CCGGATTCAGCCTTCTCCATATTAACTCGAGTTAATATGGAGAAGGCTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-3923s21c1
Sequence:CCGGGCAACCTTCTGAAACGCTAAACTCGAGTTTAGCGTTTCAGAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-3589s21c1
Sequence:CCGGCAGATAGCAAGAGTGAATATTCTCGAGAATATTCACTCTTGCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003035.2-867s21c1
Sequence:CCGGATGGATGAAACACGCAAATTGCTCGAGCAATTTGCGTGTTTCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003035.x-4474s1c1
Sequence:CCGGGATCAGTTATTCCTACAAGTTCTCGAGAACTTGTAGGAATAACTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003035.x-1933s1c1
Sequence:CCGGCCAGGAACAGTATTAAACCATCTCGAGATGGTTTAATACTGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003035.x-1172s1c1
Sequence:CCGGGTCTGGAATTACACATATCTACTCGAGTAGATATGTGTAATTCCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003035.x-3494s1c1
Sequence:CCGGTGGATTAAACTGCATGTCATTCTCGAGAATGACATGCAGTTTAATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003035.x-1740s1c1
Sequence:CCGGCCTTTGATTAACCACTTGGAACTCGAGTTCCAAGTGGTTAATCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009185
VALIDATED
STIL MISSION shRNA Bacterial Glycerol Stock
SCL/TAL1 interrupting locus
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009185.3-5097s1c1
Sequence:CCGGGTACTGTCTTACTCCAAATAACTCGAGTTATTTGGAGTAAGACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009185.3-3059s1c1
Sequence:CCGGGTGAACCACCTACTAAGTAACCTCGAGGTTACTTAGTAGGTGGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009185.3-1241s21c1
Sequence:CCGGCCCGACCTTCAGTTTCAGTTACTCGAGTAACTGAAACTGAAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009185.3-569s21c1
Sequence:CCGGTTTGATCCTGGTCGAGAAATACTCGAGTATTTCTCGACCAGGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009185.3-947s21c1
Sequence:CCGGCAAGTTCAGGGAACCTATAAACTCGAGTTTATAGGTTCCCTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009185.3-4485s21c1
Sequence:CCGGGCCGCAGCTAATCAAGTTCAACTCGAGTTGAACTTGATTAGCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009185.3-1771s21c1
Sequence:CCGGGCAGTCATCTACCTGTAAGAACTCGAGTTCTTACAGGTAGATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009185.1-1159s1c1
Sequence:CCGGCCCGACCTTCAGTTTCAGTTACTCGAGTAACTGAAACTGAAGGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009185.1-2894s1c1
Sequence:CCGGGCACTGAATTACCACAGGGAACTCGAGTTCCCTGTGGTAATTCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009185.1-4403s1c1
Sequence:CCGGGCCGCAGCTAATCAAGTTCAACTCGAGTTGAACTTGATTAGCTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009185.1-1689s1c1
Sequence:CCGGGCAGTCATCTACCTGTAAGAACTCGAGTTCTTACAGGTAGATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009185.1-1774s1c1
Sequence:CCGGGCTGAGAAACTTCAAGCAGTTCTCGAGAACTGCTTGAAGTTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009185.1-388s1c1
Sequence:CCGGCGTCATGCTAAGCAGAATAAACTCGAGTTTATTCTGCTTAGCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009185
VALIDATED
STIL MISSION shRNA shRNA Plasmid DNA
SCL/TAL1 interrupting locus
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009185.3-5097s1c1
Sequence:CCGGGTACTGTCTTACTCCAAATAACTCGAGTTATTTGGAGTAAGACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009185.3-3059s1c1
Sequence:CCGGGTGAACCACCTACTAAGTAACCTCGAGGTTACTTAGTAGGTGGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009185.3-1241s21c1
Sequence:CCGGCCCGACCTTCAGTTTCAGTTACTCGAGTAACTGAAACTGAAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009185.3-569s21c1
Sequence:CCGGTTTGATCCTGGTCGAGAAATACTCGAGTATTTCTCGACCAGGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009185.3-947s21c1
Sequence:CCGGCAAGTTCAGGGAACCTATAAACTCGAGTTTATAGGTTCCCTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009185.3-4485s21c1
Sequence:CCGGGCCGCAGCTAATCAAGTTCAACTCGAGTTGAACTTGATTAGCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009185.3-1771s21c1
Sequence:CCGGGCAGTCATCTACCTGTAAGAACTCGAGTTCTTACAGGTAGATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009185.1-1159s1c1
Sequence:CCGGCCCGACCTTCAGTTTCAGTTACTCGAGTAACTGAAACTGAAGGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009185.1-2894s1c1
Sequence:CCGGGCACTGAATTACCACAGGGAACTCGAGTTCCCTGTGGTAATTCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009185.1-4403s1c1
Sequence:CCGGGCCGCAGCTAATCAAGTTCAACTCGAGTTGAACTTGATTAGCTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009185.1-1689s1c1
Sequence:CCGGGCAGTCATCTACCTGTAAGAACTCGAGTTCTTACAGGTAGATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009185.1-1774s1c1
Sequence:CCGGGCTGAGAAACTTCAAGCAGTTCTCGAGAACTGCTTGAAGTTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009185.1-388s1c1
Sequence:CCGGCGTCATGCTAAGCAGAATAAACTCGAGTTTATTCTGCTTAGCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009185
VALIDATED
STIL MISSION shRNA Lentiviral Transduction Particles
SCL/TAL1 interrupting locus
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009185.3-5097s1c1
Sequence:CCGGGTACTGTCTTACTCCAAATAACTCGAGTTATTTGGAGTAAGACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009185.3-3059s1c1
Sequence:CCGGGTGAACCACCTACTAAGTAACCTCGAGGTTACTTAGTAGGTGGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009185.3-1241s21c1
Sequence:CCGGCCCGACCTTCAGTTTCAGTTACTCGAGTAACTGAAACTGAAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009185.3-569s21c1
Sequence:CCGGTTTGATCCTGGTCGAGAAATACTCGAGTATTTCTCGACCAGGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009185.3-947s21c1
Sequence:CCGGCAAGTTCAGGGAACCTATAAACTCGAGTTTATAGGTTCCCTGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009185.3-4485s21c1
Sequence:CCGGGCCGCAGCTAATCAAGTTCAACTCGAGTTGAACTTGATTAGCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009185.3-1771s21c1
Sequence:CCGGGCAGTCATCTACCTGTAAGAACTCGAGTTCTTACAGGTAGATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009185.1-1159s1c1
Sequence:CCGGCCCGACCTTCAGTTTCAGTTACTCGAGTAACTGAAACTGAAGGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009185.1-2894s1c1
Sequence:CCGGGCACTGAATTACCACAGGGAACTCGAGTTCCCTGTGGTAATTCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009185.1-4403s1c1
Sequence:CCGGGCCGCAGCTAATCAAGTTCAACTCGAGTTGAACTTGATTAGCTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009185.1-1689s1c1
Sequence:CCGGGCAGTCATCTACCTGTAAGAACTCGAGTTCTTACAGGTAGATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009185.1-1774s1c1
Sequence:CCGGGCTGAGAAACTTCAAGCAGTTCTCGAGAACTGCTTGAAGTTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009185.1-388s1c1
Sequence:CCGGCGTCATGCTAAGCAGAATAAACTCGAGTTTATTCTGCTTAGCATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks