EMAIL THIS PAGE TO A FRIEND

STIM1

stromal interaction molecule 1

Synonyms: D11S4896E GOK TAM
UniProtKB ID: Q13586, Q8N382
Gene ID:
Human(6786) Summary: This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(20866) stromal interaction molecule 1
Rat(361618) stromal interaction molecule 1
chicken(419082) stromal interaction molecule 1
dog(608643) stromal interaction molecule 1
Horse(100053079) stromal interaction molecule 1
domestic cat(101087780) stromal interaction molecule 1
naked mole-rat(101707184) stromal interaction molecule 1
Domestic Rabbit(100345564) stromal interaction molecule 1
domestic guinea pig(100728201) stromal interaction molecule 1
cow(534816) stromal interaction molecule 1
sheep(101116424) stromal interaction molecule 1
172 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
S6197 Anti-STIM1 (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunofluorescence, immunoprecipitation, western blot pricing
S6072 Anti-STIM1 (N-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunofluorescence, immunoprecipitation, western blot pricing
SAB2501933 Anti-STIM1 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human, mouse, rat
ELISA, western blot pricing
HPA011088 Anti-STIM1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA012123 Anti-STIM1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500365 Anti-STIM1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
WH0006786M1 Monoclonal Anti-STIM1 antibody produced in mouse clone 5A2, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404421 Monoclonal Anti-STIM1, (C-terminal) antibody produced in mouse clone 6C6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003156 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003156 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003156 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009287 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009287 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009287 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003156 Rosetta Predictions human pricing
NM_001108496 Rosetta Predictions rat pricing
NM_009287 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107803 predicted 2102
2 SASI_Hs01_00107804 predicted 2008
3 SASI_Hs01_00107805 predicted 1968
4 SASI_Hs02_00335162 predicted 846
5 SASI_Hs01_00107806 predicted 2381
6 SASI_Hs01_00107807 predicted 1242
7 SASI_Hs01_00107808 predicted 825
8 SASI_Hs02_00335163 predicted 1616
9 SASI_Hs01_00107809 predicted 1001
10 SASI_Hs01_00107810 predicted 759
11 SASI_Hs01_00107811 predicted 873
12 SASI_Hs01_00107812 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108496 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239219 predicted 1085
2 SASI_Rn02_00239220 predicted 2434
3 SASI_Rn02_00239221 predicted 444
4 SASI_Rn02_00239222 predicted 2200
5 SASI_Rn02_00239223 predicted 2428
6 SASI_Rn02_00239224 predicted 2366
7 SASI_Rn02_00239225 predicted 1913
8 SASI_Rn02_00239226 predicted 1061
9 SASI_Rn02_00239227 predicted 2351
10 SASI_Rn02_00239228 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169472 predicted 2127
2 SASI_Mm01_00169473 predicted 2626
3 SASI_Mm01_00169474 predicted 2036
4 SASI_Mm01_00169475 predicted 999
5 SASI_Mm01_00169476 predicted 1276
6 SASI_Mm01_00169477 predicted 1319
7 SASI_Mm01_00169478 predicted 2649
8 SASI_Mm02_00315794 predicted 1032
9 SASI_Mm01_00169479 predicted 853
10 SASI_Mm01_00169480 predicted 2339
11 SASI_Mm01_00169481 predicted 1604
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003156
STIM1 MISSION shRNA Bacterial Glycerol Stock
stromal interaction molecule 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003156.2-1424s1c1
Sequence:CCGGCGATGAGATCAACCTTGCTAACTCGAGTTAGCAAGGTTGATCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003156.2-1766s1c1
Sequence:CCGGCCTGGATGATGTAGATCATAACTCGAGTTATGATCTACATCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180131    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003156.2-3085s1c1
Sequence:CCGGCCACTCACAGTGGTTCTGTTTCTCGAGAAACAGAACCACTGTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003156.2-2383s1c1
Sequence:CCGGGCTCTCCACATTTGGATTCTTCTCGAGAAGAATCCAAATGTGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003156.3-1244s21c1
Sequence:CCGGGGCTGCTGGTTTGCCTATATCCTCGAGGATATAGGCAAACCAGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003156.3-1630s21c1
Sequence:CCGGACATGAGGTGGAGGTGCAATACTCGAGTATTGCACCTCCACCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003156.3-1215s21c1
Sequence:CCGGTGGTGGTGTCTATCGTTATTGCTCGAGCAATAACGATAGACACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003156.3-1175s21c1
Sequence:CCGGCCTCTCTTGACTCGCCATAATCTCGAGATTATGGCGAGTCAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003156.3-980s21c1
Sequence:CCGGGTACAGTGGCTGATCACATATCTCGAGATATGTGATCAGCCACTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003156
STIM1 MISSION shRNA shRNA Plasmid DNA
stromal interaction molecule 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003156.2-1424s1c1
Sequence:CCGGCGATGAGATCAACCTTGCTAACTCGAGTTAGCAAGGTTGATCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003156.2-1766s1c1
Sequence:CCGGCCTGGATGATGTAGATCATAACTCGAGTTATGATCTACATCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180131    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003156.2-3085s1c1
Sequence:CCGGCCACTCACAGTGGTTCTGTTTCTCGAGAAACAGAACCACTGTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003156.2-2383s1c1
Sequence:CCGGGCTCTCCACATTTGGATTCTTCTCGAGAAGAATCCAAATGTGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003156.3-1244s21c1
Sequence:CCGGGGCTGCTGGTTTGCCTATATCCTCGAGGATATAGGCAAACCAGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003156.3-1630s21c1
Sequence:CCGGACATGAGGTGGAGGTGCAATACTCGAGTATTGCACCTCCACCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003156.3-1215s21c1
Sequence:CCGGTGGTGGTGTCTATCGTTATTGCTCGAGCAATAACGATAGACACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003156.3-1175s21c1
Sequence:CCGGCCTCTCTTGACTCGCCATAATCTCGAGATTATGGCGAGTCAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003156.3-980s21c1
Sequence:CCGGGTACAGTGGCTGATCACATATCTCGAGATATGTGATCAGCCACTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003156
STIM1 MISSION shRNA Lentiviral Transduction Particles
stromal interaction molecule 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003156.2-1424s1c1
Sequence:CCGGCGATGAGATCAACCTTGCTAACTCGAGTTAGCAAGGTTGATCTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003156.2-1766s1c1
Sequence:CCGGCCTGGATGATGTAGATCATAACTCGAGTTATGATCTACATCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180131    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003156.2-3085s1c1
Sequence:CCGGCCACTCACAGTGGTTCTGTTTCTCGAGAAACAGAACCACTGTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003156.2-2383s1c1
Sequence:CCGGGCTCTCCACATTTGGATTCTTCTCGAGAAGAATCCAAATGTGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003156.3-1244s21c1
Sequence:CCGGGGCTGCTGGTTTGCCTATATCCTCGAGGATATAGGCAAACCAGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003156.3-1630s21c1
Sequence:CCGGACATGAGGTGGAGGTGCAATACTCGAGTATTGCACCTCCACCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003156.3-1215s21c1
Sequence:CCGGTGGTGGTGTCTATCGTTATTGCTCGAGCAATAACGATAGACACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003156.3-1175s21c1
Sequence:CCGGCCTCTCTTGACTCGCCATAATCTCGAGATTATGGCGAGTCAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003156.3-980s21c1
Sequence:CCGGGTACAGTGGCTGATCACATATCTCGAGATATGTGATCAGCCACTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009287
VALIDATED
STIM1 MISSION shRNA Bacterial Glycerol Stock
stromal interaction molecule 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009287.2-797s1c1
Sequence:CCGGCCGAAACATCCATAAGCTGATCTCGAGATCAGCTTATGGATGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009287.2-2329s1c1
Sequence:CCGGCCAAGAAGACATTTATGGCGTCTCGAGACGCCATAAATGTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009287.2-2712s1c1
Sequence:CCGGCCCTTCCTTTCTTTGCAATATCTCGAGATATTGCAAAGAAAGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009287.2-1901s1c1
Sequence:CCGGCTGCGGTTTCCAGATTGTCAACTCGAGTTGACAATCTGGAAACCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009287.2-1670s1c1
Sequence:CCGGGCAGTACTACAACATCAAGAACTCGAGTTCTTGATGTTGTAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009287.2-2333s1c1
Sequence:CCGGGAAGACATTTATGGCGTTGAACTCGAGTTCAACGCCATAAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009287.4-909s21c1
Sequence:CCGGCACCTTCCATGGTGAGGATAACTCGAGTTATCCTCACCATGGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009287.4-999s21c1
Sequence:CCGGGGTGATACAGTGGCTCATTACCTCGAGGTAATGAGCCACTGTATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009287.4-1267s21c1
Sequence:CCGGGGCTGCTGGTTTGCCTATATCCTCGAGGATATAGGCAAACCAGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009287.4-1795s1c1
Sequence:CCGGCTGGATGATGTGGATCATAAACTCGAGTTTATGATCCACATCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009287.4-2424s21c1
Sequence:CCGGGGATTCTTCCCATTCTCTTAGCTCGAGCTAAGAGAATGGGAAGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009287.4-2024s21c1
Sequence:CCGGATGACATGGATGAGGAGATTGCTCGAGCAATCTCCTCATCCATGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009287
VALIDATED
STIM1 MISSION shRNA shRNA Plasmid DNA
stromal interaction molecule 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009287.2-797s1c1
Sequence:CCGGCCGAAACATCCATAAGCTGATCTCGAGATCAGCTTATGGATGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009287.2-2329s1c1
Sequence:CCGGCCAAGAAGACATTTATGGCGTCTCGAGACGCCATAAATGTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009287.2-2712s1c1
Sequence:CCGGCCCTTCCTTTCTTTGCAATATCTCGAGATATTGCAAAGAAAGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009287.2-1901s1c1
Sequence:CCGGCTGCGGTTTCCAGATTGTCAACTCGAGTTGACAATCTGGAAACCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009287.2-1670s1c1
Sequence:CCGGGCAGTACTACAACATCAAGAACTCGAGTTCTTGATGTTGTAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009287.2-2333s1c1
Sequence:CCGGGAAGACATTTATGGCGTTGAACTCGAGTTCAACGCCATAAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009287.4-909s21c1
Sequence:CCGGCACCTTCCATGGTGAGGATAACTCGAGTTATCCTCACCATGGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009287.4-999s21c1
Sequence:CCGGGGTGATACAGTGGCTCATTACCTCGAGGTAATGAGCCACTGTATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009287.4-1267s21c1
Sequence:CCGGGGCTGCTGGTTTGCCTATATCCTCGAGGATATAGGCAAACCAGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009287.4-1795s1c1
Sequence:CCGGCTGGATGATGTGGATCATAAACTCGAGTTTATGATCCACATCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009287.4-2424s21c1
Sequence:CCGGGGATTCTTCCCATTCTCTTAGCTCGAGCTAAGAGAATGGGAAGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009287.4-2024s21c1
Sequence:CCGGATGACATGGATGAGGAGATTGCTCGAGCAATCTCCTCATCCATGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009287
VALIDATED
STIM1 MISSION shRNA Lentiviral Transduction Particles
stromal interaction molecule 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009287.2-797s1c1
Sequence:CCGGCCGAAACATCCATAAGCTGATCTCGAGATCAGCTTATGGATGTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009287.2-2329s1c1
Sequence:CCGGCCAAGAAGACATTTATGGCGTCTCGAGACGCCATAAATGTCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009287.2-2712s1c1
Sequence:CCGGCCCTTCCTTTCTTTGCAATATCTCGAGATATTGCAAAGAAAGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009287.2-1901s1c1
Sequence:CCGGCTGCGGTTTCCAGATTGTCAACTCGAGTTGACAATCTGGAAACCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009287.2-1670s1c1
Sequence:CCGGGCAGTACTACAACATCAAGAACTCGAGTTCTTGATGTTGTAGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009287.2-2333s1c1
Sequence:CCGGGAAGACATTTATGGCGTTGAACTCGAGTTCAACGCCATAAATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009287.4-909s21c1
Sequence:CCGGCACCTTCCATGGTGAGGATAACTCGAGTTATCCTCACCATGGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009287.4-999s21c1
Sequence:CCGGGGTGATACAGTGGCTCATTACCTCGAGGTAATGAGCCACTGTATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009287.4-1267s21c1
Sequence:CCGGGGCTGCTGGTTTGCCTATATCCTCGAGGATATAGGCAAACCAGCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009287.4-1795s1c1
Sequence:CCGGCTGGATGATGTGGATCATAAACTCGAGTTTATGATCCACATCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009287.4-2424s21c1
Sequence:CCGGGGATTCTTCCCATTCTCTTAGCTCGAGCTAAGAGAATGGGAAGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009287.4-2024s21c1
Sequence:CCGGATGACATGGATGAGGAGATTGCTCGAGCAATCTCCTCATCCATGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks