EMAIL THIS PAGE TO A FRIEND

STIM2

stromal interaction molecule 2

UniProtKB ID: Q9P246, Q96BF1, Q9BQH2, Q9H8R1
Gene ID:
Human(57620) Summary: This gene is a member of the stromal interaction molecule (STIM) family and likely arose, along with related family member STIM1, from a common ancestral gene. The encoded protein functions to regulate calcium concentrations in the cytosol and endoplasmic reticulum, and is involved in the activation of plasma membrane Orai Ca(2+) entry channels. This gene initiates translation from a non-AUG (UUG) start site. A signal peptide is cleaved from the resulting protein. Multiple transcript variants result from alternative splicing. [provided by RefSeq, Dec 2009]
Mouse(116873) stromal interaction molecule 2
Rat(117087) stromal interaction molecule 2
Zebrafish(563901) stromal interaction molecule 2
dog(479120) stromal interaction molecule 2
domestic cat(101100466) stromal interaction molecule 2
Zebrafish(100334881) stromal interaction molecule 2
chicken(422799) stromal interaction molecule 2
cow(541299) stromal interaction molecule 2
sheep(101106079) stromal interaction molecule 2
domestic guinea pig(100715969) stromal interaction molecule 2
Domestic Rabbit(100351226) stromal interaction molecule 2
naked mole-rat(101709719) stromal interaction molecule 2
213 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020860 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_132038 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_132038 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_132038 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020860 Rosetta Predictions human pricing
NM_001105750 Rosetta Predictions rat pricing
NM_001081103 Rosetta Predictions mouse pricing
XM_132038 Rosetta Predictions mouse pricing
XM_900292 Rosetta Predictions mouse pricing
XM_900300 Rosetta Predictions mouse pricing
XM_900306 Rosetta Predictions mouse pricing
XM_923814 Rosetta Predictions mouse pricing
XM_991199 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354130 predicted 1002
2 SASI_Hs02_00354131 predicted 1787
3 SASI_Hs01_00146914 predicted 900
4 SASI_Hs02_00354132 predicted 2355
5 SASI_Hs01_00146915 predicted 1264
6 SASI_Hs01_00146916 predicted 1593
7 SASI_Hs01_00146917 predicted 1252
8 SASI_Hs01_00146919 predicted 956
9 SASI_Hs02_00354133 predicted 1348
10 SASI_Hs02_00354134 predicted 1242
11 SASI_Hs01_00146912 predicted 2387
12 SASI_Hs01_00146913 predicted 2363
13 SASI_Hs01_00146918 predicted 1586
14 SASI_Hs01_00146920 predicted 2208
15 SASI_Hs01_00146921 predicted 2217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212166 predicted 417
2 SASI_Rn02_00212167 predicted 1035
3 SASI_Rn02_00212168 predicted 996
4 SASI_Rn02_00212169 predicted 555
5 SASI_Rn02_00212170 predicted 2464
6 SASI_Rn02_00212171 predicted 608
7 SASI_Rn02_00212172 predicted 872
8 SASI_Rn02_00212173 predicted 711
9 SASI_Rn02_00212174 predicted 2443
10 SASI_Rn02_00212175 predicted 1952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295211 predicted 786
2 SASI_Mm02_00295212 predicted 2599
3 SASI_Mm02_00295213 predicted 303
4 SASI_Mm02_00295214 predicted 1832
5 SASI_Mm02_00295215 predicted 2090
6 SASI_Mm02_00295216 predicted 813
7 SASI_Mm02_00295217 predicted 2498
8 SASI_Mm02_00295218 predicted 2114
9 SASI_Mm02_00295219 predicted 1096
10 SASI_Mm02_00295220 predicted 1579
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132038 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224593 predicted 2597
2 SASI_Mm01_00224594 predicted 622
3 SASI_Mm01_00224595 predicted 315
4 SASI_Mm01_00224596 predicted 1838
5 SASI_Mm01_00224597 predicted 2089
6 SASI_Mm01_00224598 predicted 833
7 SASI_Mm01_00224599 predicted 822
8 SASI_Mm01_00224600 predicted 2501
9 SASI_Mm01_00224601 predicted 2118
10 SASI_Mm01_00224602 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255224 predicted 953
2 SASI_Mm01_00255225 predicted 1903
3 SASI_Mm01_00255226 predicted 1424
4 SASI_Mm01_00255227 predicted 1136
5 SASI_Mm01_00255228 predicted 1072
6 SASI_Mm01_00255229 predicted 1391
7 SASI_Mm01_00255230 predicted 1799
8 SASI_Mm01_00255231 predicted 886
9 SASI_Mm01_00255232 predicted 870
10 SASI_Mm01_00255233 predicted 1766
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900300 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262722 predicted 2627
2 SASI_Mm01_00262723 predicted 672
3 SASI_Mm01_00262724 predicted 361
4 SASI_Mm01_00262725 predicted 1862
5 SASI_Mm01_00262726 predicted 2117
6 SASI_Mm01_00262727 predicted 871
7 SASI_Mm01_00262728 predicted 871
8 SASI_Mm01_00262729 predicted 2521
9 SASI_Mm01_00262730 predicted 2144
10 SASI_Mm01_00262731 predicted 1151
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231933 predicted 838
2 SASI_Mm01_00231934 predicted 362
3 SASI_Mm01_00231935 predicted 325
4 SASI_Mm01_00231936 predicted 731
5 SASI_Mm01_00231937 predicted 929
6 SASI_Mm01_00231938 predicted 966
7 SASI_Mm01_00231939 predicted 947
8 SASI_Mm01_00231940 predicted 707
9 SASI_Mm01_00231941 predicted 280
10 SASI_Mm01_00231942 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_923814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246837 predicted 2111
2 SASI_Mm01_00246838 predicted 1343
3 SASI_Mm01_00246839 predicted 1601
4 SASI_Mm01_00246840 predicted 359
5 SASI_Mm01_00246841 predicted 354
6 SASI_Mm01_00246842 predicted 2007
7 SASI_Mm01_00246843 predicted 1631
8 SASI_Mm01_00246844 predicted 630
9 SASI_Mm01_00246845 predicted 1094
10 SASI_Mm01_00246846 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208429 predicted 2438
2 SASI_Mm01_00208430 predicted 626
3 SASI_Mm01_00208431 predicted 315
4 SASI_Mm01_00208432 predicted 1672
5 SASI_Mm01_00208433 predicted 1936
6 SASI_Mm01_00208434 predicted 832
7 SASI_Mm01_00208435 predicted 822
8 SASI_Mm01_00208436 predicted 2340
9 SASI_Mm01_00208437 predicted 1962
10 SASI_Mm01_00208438 predicted 1111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020860
STIM2 MISSION shRNA Bacterial Glycerol Stock
stromal interaction molecule 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020860.3-1850s21c1
Sequence:CCGGGTGGCTTTCAGATAGCCCATACTCGAGTATGGGCTATCTGAAAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020860.3-946s21c1
Sequence:CCGGGACACTCTTCAGTGGTTGATACTCGAGTATCAACCACTGAAGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020860.1-2231s1c1
Sequence:CCGGCCCTGCGCTTTATCGAAATGACTCGAGTCATTTCGATAAAGCGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020860.1-3176s1c1
Sequence:CCGGGCTATTTACATCCTGGACTATCTCGAGATAGTCCAGGATGTAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020860.1-1049s1c1
Sequence:CCGGGCACGAACCTTCATTTATGATCTCGAGATCATAAATGAAGGTTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020860.1-3449s1c1
Sequence:CCGGCGCTGTAAAGATCATGTTGTTCTCGAGAACAACATGATCTTTACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020860.1-924s1c1
Sequence:CCGGGAAGTTCATAATTGGACCCTTCTCGAGAAGGGTCCAATTATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020860.1-4879s1c1
Sequence:CCGGGCTCAATTTCAGACACTCATTCTCGAGAATGAGTGTCTGAAATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020860.1-2691s1c1
Sequence:CCGGCCACATGACCTTTGTCATAATCTCGAGATTATGACAAAGGTCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020860
STIM2 MISSION shRNA shRNA Plasmid DNA
stromal interaction molecule 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020860.3-1850s21c1
Sequence:CCGGGTGGCTTTCAGATAGCCCATACTCGAGTATGGGCTATCTGAAAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020860.3-946s21c1
Sequence:CCGGGACACTCTTCAGTGGTTGATACTCGAGTATCAACCACTGAAGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020860.1-2231s1c1
Sequence:CCGGCCCTGCGCTTTATCGAAATGACTCGAGTCATTTCGATAAAGCGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020860.1-3176s1c1
Sequence:CCGGGCTATTTACATCCTGGACTATCTCGAGATAGTCCAGGATGTAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020860.1-1049s1c1
Sequence:CCGGGCACGAACCTTCATTTATGATCTCGAGATCATAAATGAAGGTTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020860.1-3449s1c1
Sequence:CCGGCGCTGTAAAGATCATGTTGTTCTCGAGAACAACATGATCTTTACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020860.1-924s1c1
Sequence:CCGGGAAGTTCATAATTGGACCCTTCTCGAGAAGGGTCCAATTATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020860.1-4879s1c1
Sequence:CCGGGCTCAATTTCAGACACTCATTCTCGAGAATGAGTGTCTGAAATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020860.1-2691s1c1
Sequence:CCGGCCACATGACCTTTGTCATAATCTCGAGATTATGACAAAGGTCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020860
STIM2 MISSION shRNA Lentiviral Transduction Particles
stromal interaction molecule 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020860.3-1850s21c1
Sequence:CCGGGTGGCTTTCAGATAGCCCATACTCGAGTATGGGCTATCTGAAAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020860.3-946s21c1
Sequence:CCGGGACACTCTTCAGTGGTTGATACTCGAGTATCAACCACTGAAGAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020860.1-2231s1c1
Sequence:CCGGCCCTGCGCTTTATCGAAATGACTCGAGTCATTTCGATAAAGCGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020860.1-3176s1c1
Sequence:CCGGGCTATTTACATCCTGGACTATCTCGAGATAGTCCAGGATGTAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020860.1-1049s1c1
Sequence:CCGGGCACGAACCTTCATTTATGATCTCGAGATCATAAATGAAGGTTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151484    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020860.1-3449s1c1
Sequence:CCGGCGCTGTAAAGATCATGTTGTTCTCGAGAACAACATGATCTTTACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020860.1-924s1c1
Sequence:CCGGGAAGTTCATAATTGGACCCTTCTCGAGAAGGGTCCAATTATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020860.1-4879s1c1
Sequence:CCGGGCTCAATTTCAGACACTCATTCTCGAGAATGAGTGTCTGAAATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020860.1-2691s1c1
Sequence:CCGGCCACATGACCTTTGTCATAATCTCGAGATTATGACAAAGGTCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_132038
VALIDATED
STIM2 MISSION shRNA Bacterial Glycerol Stock
stromal interaction molecule 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132038.3-486s1c1
Sequence:CCGGCCACCTTGCTTCACTGAAGAACTCGAGTTCTTCAGTGAAGCAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132038.3-517s1c1
Sequence:CCGGGCTTGGAAGCACTTCAGACAACTCGAGTTGTCTGAAGTGCTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132038.3-2483s1c1
Sequence:CCGGCCTCTGTCATAATGGTGAGAACTCGAGTTCTCACCATTATGACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132038.3-1533s1c1
Sequence:CCGGGACGAAGTAGACCACAAGATTCTCGAGAATCTTGTGGTCTACTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132038.3-2094s1c1
Sequence:CCGGGCTTCAGAATGTGACTCCTTACTCGAGTAAGGAGTCACATTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_132038
VALIDATED
STIM2 MISSION shRNA shRNA Plasmid DNA
stromal interaction molecule 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132038.3-486s1c1
Sequence:CCGGCCACCTTGCTTCACTGAAGAACTCGAGTTCTTCAGTGAAGCAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132038.3-517s1c1
Sequence:CCGGGCTTGGAAGCACTTCAGACAACTCGAGTTGTCTGAAGTGCTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132038.3-2483s1c1
Sequence:CCGGCCTCTGTCATAATGGTGAGAACTCGAGTTCTCACCATTATGACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132038.3-1533s1c1
Sequence:CCGGGACGAAGTAGACCACAAGATTCTCGAGAATCTTGTGGTCTACTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132038.3-2094s1c1
Sequence:CCGGGCTTCAGAATGTGACTCCTTACTCGAGTAAGGAGTCACATTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_132038
VALIDATED
STIM2 MISSION shRNA Lentiviral Transduction Particles
stromal interaction molecule 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132038.3-486s1c1
Sequence:CCGGCCACCTTGCTTCACTGAAGAACTCGAGTTCTTCAGTGAAGCAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132038.3-517s1c1
Sequence:CCGGGCTTGGAAGCACTTCAGACAACTCGAGTTGTCTGAAGTGCTTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132038.3-2483s1c1
Sequence:CCGGCCTCTGTCATAATGGTGAGAACTCGAGTTCTCACCATTATGACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132038.3-1533s1c1
Sequence:CCGGGACGAAGTAGACCACAAGATTCTCGAGAATCTTGTGGTCTACTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_132038.3-2094s1c1
Sequence:CCGGGCTTCAGAATGTGACTCCTTACTCGAGTAAGGAGTCACATTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks