EMAIL THIS PAGE TO A FRIEND

STIP1

stress-induced-phosphoprotein 1

Synonyms: HOP IEF-SSP-3521 P60 STI1 STI1L
UniProtKB ID: P31948, Q5TZU9
Gene ID:
Human(10963) Summary: STIP1 is an adaptor protein that coordinates the functions of HSP70 (see HSPA1A; MIM 140550) and HSP90 (see HSP90AA1; MIM 140571) in protein folding. It is thought to assist in the transfer of proteins from HSP70 to HSP90 by binding both HSP90 and substrate-bound HSP70. STIP1 also stimulates the ATPase activity of HSP70 and inhibits the ATPase activity of HSP90, suggesting that it regulates both the conformations and ATPase cycles of these chaperones (Song and Masison, 2005 [PubMed 16100115]
Mouse(20867) stress-induced phosphoprotein 1
Rat(192277) stress-induced phosphoprotein 1
Zebrafish(493606) stress-induced-phosphoprotein 1 (Hsp70/Hsp90-organizing protein)
dog(474837) stress-induced-phosphoprotein 1
domestic cat(101097762) stress-induced-phosphoprotein 1
Domestic Rabbit(100356266) stress-induced-phosphoprotein 1
naked mole-rat(101704359) stress-induced-phosphoprotein 1
domestic guinea pig(100732747) stress-induced-phosphoprotein 1
cow(617109) stress-induced-phosphoprotein 1
sheep(101122561) stress-induced-phosphoprotein 1
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV46164 Anti-STIP1 (AB1) antibody produced in rabbit IgG fraction of antiserum rabbit, human, guinea pig, bovine, rat, horse, canine, mouse
western blot pricing
AV46165 Anti-STIP1 (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, horse, guinea pig, canine, human, mouse, rabbit, rat
immunohistochemistry, western blot pricing
GW22824 Anti-STIP1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse
western blot pricing
SAB1407079 Anti-STIP1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA044062 Anti-STIP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA039291 Anti-STIP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
WH0010963M1 Monoclonal Anti-STIP1 antibody produced in mouse clone 4B6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1408802 Monoclonal Anti-STIP1 antibody produced in mouse clone 2E1, purified immunoglobulin, buffered aqueous solution human
ELISA, flow cytometry, immunohistochemistry, western blot pricing
SAB1408803 Monoclonal Anti-STIP1 antibody produced in mouse clone 2E11, purified immunoglobulin, buffered aqueous solution human
ELISA, flow cytometry, immunohistochemistry, western blot pricing
SAB1408804 Monoclonal Anti-STIP1 antibody produced in mouse clone 1C6, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
SAB1408805 Monoclonal Anti-STIP1 antibody produced in mouse clone 1B10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404882 Monoclonal Anti-STIP1, (C-terminal) antibody produced in mouse clone 1E3, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006819 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016737 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016737 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016737 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU047411 MISSION® esiRNA esiRNA targeting mouse Stip1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006819 Rosetta Predictions human pricing
NM_138911 Rosetta Predictions rat pricing
NM_016737 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126805 predicted 1554
2 SASI_Hs01_00126806 predicted 864
3 SASI_Hs01_00126807 predicted 446
4 SASI_Hs01_00126808 predicted 523
5 SASI_Hs02_00342364 predicted 844
6 SASI_Hs01_00126809 predicted 1460
7 SASI_Hs01_00126811 predicted 422
8 SASI_Hs01_00126812 predicted 602
9 SASI_Hs01_00126813 predicted 577
10 SASI_Hs01_00126814 predicted 914
11 SASI_Hs01_00126810 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113911 predicted 1774
2 SASI_Rn01_00113912 predicted 1009
3 SASI_Rn01_00113913 predicted 616
4 SASI_Rn01_00113914 predicted 828
5 SASI_Rn01_00113915 predicted 343
6 SASI_Rn01_00113916 predicted 1330
7 SASI_Rn01_00113917 predicted 1016
8 SASI_Rn02_00268391 predicted 1106
9 SASI_Rn01_00113918 predicted 305
10 SASI_Rn01_00113920 predicted 970
11 SASI_Rn01_00113919 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022895 predicted 425
2 SASI_Mm02_00323436 predicted 1609
3 SASI_Mm01_00022896 predicted 208
4 SASI_Mm01_00022897 predicted 1154
5 SASI_Mm02_00323437 predicted 1323
6 SASI_Mm01_00022898 predicted 373
7 SASI_Mm02_00323438 predicted 324
8 SASI_Mm02_00323439 predicted 957
9 SASI_Mm02_00323440 predicted 992
10 SASI_Mm02_00323441 predicted 856
11 SASI_Mm01_00022899 predicted 1770
12 SASI_Mm01_00022900 predicted 1015
13 SASI_Mm01_00022901 predicted 1571
14 SASI_Mm01_00022902 predicted 199
15 SASI_Mm01_00022903 predicted 221
16 SASI_Mm01_00022904 predicted 896
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006819
VALIDATED
STIP1 MISSION shRNA Bacterial Glycerol Stock
stress-induced-phosphoprotein 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006819.1-1619s1c1
Sequence:CCGGCGAACACTTAAAGAATCCTGTCTCGAGACAGGATTCTTTAAGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006819.2-1421s21c1
Sequence:CCGGCGACCTTCATCAAGGGTTATACTCGAGTATAACCCTTGATGAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006819.2-1316s21c1
Sequence:CCGGACCCGAAAGATGCCAAATTATCTCGAGATAATTTGGCATCTTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006819.2-1876s21c1
Sequence:CCGGAGGCCTCATCTCTCTATATTTCTCGAGAAATATAGAGAGATGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006819.2-222s21c1
Sequence:CCGGGTGCTACTCCGAAGCTATTAACTCGAGTTAATAGCTTCGGAGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006819.2-933s21c1
Sequence:CCGGTACCAATCAAGCAGCGGTATACTCGAGTATACCGCTGCTTGATTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006819
VALIDATED
STIP1 MISSION shRNA shRNA Plasmid DNA
stress-induced-phosphoprotein 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006819.1-1619s1c1
Sequence:CCGGCGAACACTTAAAGAATCCTGTCTCGAGACAGGATTCTTTAAGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006819.2-1421s21c1
Sequence:CCGGCGACCTTCATCAAGGGTTATACTCGAGTATAACCCTTGATGAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006819.2-1316s21c1
Sequence:CCGGACCCGAAAGATGCCAAATTATCTCGAGATAATTTGGCATCTTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006819.2-1876s21c1
Sequence:CCGGAGGCCTCATCTCTCTATATTTCTCGAGAAATATAGAGAGATGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006819.2-222s21c1
Sequence:CCGGGTGCTACTCCGAAGCTATTAACTCGAGTTAATAGCTTCGGAGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006819.2-933s21c1
Sequence:CCGGTACCAATCAAGCAGCGGTATACTCGAGTATACCGCTGCTTGATTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006819
VALIDATED
STIP1 MISSION shRNA Lentiviral Transduction Particles
stress-induced-phosphoprotein 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006819.1-1619s1c1
Sequence:CCGGCGAACACTTAAAGAATCCTGTCTCGAGACAGGATTCTTTAAGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006819.2-1421s21c1
Sequence:CCGGCGACCTTCATCAAGGGTTATACTCGAGTATAACCCTTGATGAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006819.2-1316s21c1
Sequence:CCGGACCCGAAAGATGCCAAATTATCTCGAGATAATTTGGCATCTTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006819.2-1876s21c1
Sequence:CCGGAGGCCTCATCTCTCTATATTTCTCGAGAAATATAGAGAGATGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006819.2-222s21c1
Sequence:CCGGGTGCTACTCCGAAGCTATTAACTCGAGTTAATAGCTTCGGAGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006819.2-933s21c1
Sequence:CCGGTACCAATCAAGCAGCGGTATACTCGAGTATACCGCTGCTTGATTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016737
STIP1 MISSION shRNA Bacterial Glycerol Stock
stress-induced-phosphoprotein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016737.1-1769s1c1
Sequence:CCGGGAGAAGAAAGGCTTATCTTTACTCGAGTAAAGATAAGCCTTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016737.1-1327s1c1
Sequence:CCGGGCCAACCTTCATCAAGGGTTACTCGAGTAACCCTTGATGAAGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016737.1-332s1c1
Sequence:CCGGCGAACCTATGAAGAAGGTTTACTCGAGTAAACCTTCTTCATAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016737.1-434s1c1
Sequence:CCGGCCATTCAACTTGCCTAATCTACTCGAGTAGATTAGGCAAGTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016737.1-1475s1c1
Sequence:CCGGGCACAGTACAACAGACATGATCTCGAGATCATGTCTGTTGTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016737.1-1475s21c1
Sequence:CCGGGCACAGTACAACAGACATGATCTCGAGATCATGTCTGTTGTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016737.1-1327s21c1
Sequence:CCGGGCCAACCTTCATCAAGGGTTACTCGAGTAACCCTTGATGAAGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016737.1-434s21c1
Sequence:CCGGCCATTCAACTTGCCTAATCTACTCGAGTAGATTAGGCAAGTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016737.1-1769s21c1
Sequence:CCGGGAGAAGAAAGGCTTATCTTTACTCGAGTAAAGATAAGCCTTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016737.1-332s21c1
Sequence:CCGGCGAACCTATGAAGAAGGTTTACTCGAGTAAACCTTCTTCATAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016737
STIP1 MISSION shRNA shRNA Plasmid DNA
stress-induced-phosphoprotein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016737.1-1769s1c1
Sequence:CCGGGAGAAGAAAGGCTTATCTTTACTCGAGTAAAGATAAGCCTTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016737.1-1327s1c1
Sequence:CCGGGCCAACCTTCATCAAGGGTTACTCGAGTAACCCTTGATGAAGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016737.1-332s1c1
Sequence:CCGGCGAACCTATGAAGAAGGTTTACTCGAGTAAACCTTCTTCATAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016737.1-434s1c1
Sequence:CCGGCCATTCAACTTGCCTAATCTACTCGAGTAGATTAGGCAAGTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016737.1-1475s1c1
Sequence:CCGGGCACAGTACAACAGACATGATCTCGAGATCATGTCTGTTGTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016737.1-1475s21c1
Sequence:CCGGGCACAGTACAACAGACATGATCTCGAGATCATGTCTGTTGTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016737.1-1327s21c1
Sequence:CCGGGCCAACCTTCATCAAGGGTTACTCGAGTAACCCTTGATGAAGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016737.1-434s21c1
Sequence:CCGGCCATTCAACTTGCCTAATCTACTCGAGTAGATTAGGCAAGTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016737.1-1769s21c1
Sequence:CCGGGAGAAGAAAGGCTTATCTTTACTCGAGTAAAGATAAGCCTTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016737.1-332s21c1
Sequence:CCGGCGAACCTATGAAGAAGGTTTACTCGAGTAAACCTTCTTCATAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016737
STIP1 MISSION shRNA Lentiviral Transduction Particles
stress-induced-phosphoprotein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016737.1-1769s1c1
Sequence:CCGGGAGAAGAAAGGCTTATCTTTACTCGAGTAAAGATAAGCCTTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016737.1-1327s1c1
Sequence:CCGGGCCAACCTTCATCAAGGGTTACTCGAGTAACCCTTGATGAAGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016737.1-332s1c1
Sequence:CCGGCGAACCTATGAAGAAGGTTTACTCGAGTAAACCTTCTTCATAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016737.1-434s1c1
Sequence:CCGGCCATTCAACTTGCCTAATCTACTCGAGTAGATTAGGCAAGTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016737.1-1475s1c1
Sequence:CCGGGCACAGTACAACAGACATGATCTCGAGATCATGTCTGTTGTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016737.1-1475s21c1
Sequence:CCGGGCACAGTACAACAGACATGATCTCGAGATCATGTCTGTTGTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016737.1-1327s21c1
Sequence:CCGGGCCAACCTTCATCAAGGGTTACTCGAGTAACCCTTGATGAAGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016737.1-434s21c1
Sequence:CCGGCCATTCAACTTGCCTAATCTACTCGAGTAGATTAGGCAAGTTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016737.1-1769s21c1
Sequence:CCGGGAGAAGAAAGGCTTATCTTTACTCGAGTAAAGATAAGCCTTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016737.1-332s21c1
Sequence:CCGGCGAACCTATGAAGAAGGTTTACTCGAGTAAACCTTCTTCATAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks