EMAIL THIS PAGE TO A FRIEND

STK10

serine/threonine kinase 10

Synonyms: LOK PRO2729
UniProtKB ID: O94804, A6ND35, B2R8F5, B3KMY1, Q6NSK0, Q9UIW4
Gene ID:
Human(6793) Summary: This gene encodes a member of the Ste20 family of serine/threonine protein kinases, and is similar to several known polo-like kinase kinases. The protein can associate with and phosphorylate polo-like kinase 1, and overexpression of a kinase-dead version of the protein interferes with normal cell cycle progression. The kinase can also negatively regulate interleukin 2 expression in T-cells via the mitogen activated protein kinase kinase 1 pathway. [provided by RefSeq, Jul 2008]
Mouse(20868) serine/threonine kinase 10
Rat(29398) serine/threonine kinase 10
Zebrafish(394108) serine/threonine kinase 10
chicken(416204) serine/threonine kinase 10
dog(489121) serine/threonine kinase 10
domestic cat(101098281) serine/threonine kinase 10
Horse(100069956) serine/threonine kinase 10
cow(526376) serine/threonine kinase 10
sheep(101105529) serine/threonine kinase 10
domestic guinea pig(100725132) serine/threonine kinase 10
naked mole-rat(101700102) serine/threonine kinase 10
Domestic Rabbit(100358334) serine/threonine kinase 10
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009288 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009288 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009288 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005990 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005990 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005990 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153771 MISSION® esiRNA esiRNA human STK10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005990 Rosetta Predictions human pricing
XM_001064952 Rosetta Predictions rat pricing
XM_001065000 Rosetta Predictions rat pricing
XM_577078 Rosetta Predictions rat pricing
NM_009288 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171660 predicted 2269
2 SASI_Hs01_00171661 predicted 1536
3 SASI_Hs01_00171662 predicted 1544
4 SASI_Hs01_00171663 predicted 1321
5 SASI_Hs01_00171664 predicted 2250
6 SASI_Hs02_00340685 predicted 1074
7 SASI_Hs01_00171665 predicted 1350
8 SASI_Hs01_00171666 predicted 3184
9 SASI_Hs01_00171667 predicted 592
10 SASI_Hs01_00171668 predicted 1794
11 SASI_Hs01_00171659 predicted 3021
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312335 predicted 1498
2 SASI_Rn02_00312336 predicted 2278
3 SASI_Rn02_00312337 predicted 2216
4 SASI_Rn02_00312338 predicted 2938
5 SASI_Rn02_00312339 predicted 2834
6 SASI_Rn02_00312340 predicted 2862
7 SASI_Rn02_00312341 predicted 504
8 SASI_Rn02_00312342 predicted 294
9 SASI_Rn02_00312343 predicted 409
10 SASI_Rn02_00312344 predicted 2119
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312530 predicted 1511
2 SASI_Rn02_00312531 predicted 2229
3 SASI_Rn02_00312532 predicted 2962
4 SASI_Rn02_00312533 predicted 2516
5 SASI_Rn02_00312534 predicted 2861
6 SASI_Rn02_00312535 predicted 2886
7 SASI_Rn02_00312536 predicted 2311
8 SASI_Rn02_00312537 predicted 511
9 SASI_Rn02_00312538 predicted 293
10 SASI_Rn02_00312539 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406134 predicted 1406
2 SASI_Rn02_00406135 predicted 2808
3 SASI_Rn02_00406136 predicted 1517
4 SASI_Rn02_00406137 predicted 1606
5 SASI_Rn02_00406138 predicted 2853
6 SASI_Rn02_00406139 predicted 2884
7 SASI_Rn02_00406140 predicted 2946
8 SASI_Rn02_00406141 predicted 1335
9 SASI_Rn02_00406142 predicted 2943
10 SASI_Rn02_00406143 predicted 1731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198828 predicted 2308
2 SASI_Mm02_00315795 predicted 2298
3 SASI_Mm01_00198829 predicted 2073
4 SASI_Mm01_00198830 predicted 1619
5 SASI_Mm01_00198831 predicted 1951
6 SASI_Mm01_00198832 predicted 636
7 SASI_Mm01_00198833 predicted 1032
8 SASI_Mm01_00198835 predicted 2872
9 SASI_Mm01_00198836 predicted 1721
10 SASI_Mm01_00198837 predicted 943
11 SASI_Mm01_00198834 predicted 2269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009288
VALIDATED
STK10 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 10
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009288.2-3341s21c1
Sequence:CCGGCACCGCGAACGCATCCTTATTCTCGAGAATAAGGATGCGTTCGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009288.2-1329s21c1
Sequence:CCGGCAAGAATGACAATGACTTAAACTCGAGTTTAAGTCATTGTCATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009288.2-2298s21c1
Sequence:CCGGCTGCGACAAGGAACGAGATTGCTCGAGCAATCTCGTTCCTTGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009288.2-3315s21c1
Sequence:CCGGGTGGGCACAAGCGCTACTAATCTCGAGATTAGTAGCGCTTGTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009288.2-396s21c1
Sequence:CCGGCACCTGTGACCACCCGTATATCTCGAGATATACGGGTGGTCACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009288.2-612s21c1
Sequence:CCGGGAAAGCTGGCAACGTGCTTATCTCGAGATAAGCACGTTGCCAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009288.1-147s1c1
Sequence:CCGGGAAGAGAAAGTCCCGTGAATACTCGAGTATTCACGGGACTTTCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009288.1-1550s1c1
Sequence:CCGGCGGACTGTAGCAATCTGTCTACTCGAGTAGACAGATTGCTACAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009288.1-2086s1c1
Sequence:CCGGGTGAAGAGTGAGGTTGAGAAACTCGAGTTTCTCAACCTCACTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009288.1-1620s1c1
Sequence:CCGGGAACAAAGAAACGGGCTCATTCTCGAGAATGAGCCCGTTTCTTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009288.1-2604s1c1
Sequence:CCGGGCGCGAGAAGATCAAGCAGTTCTCGAGAACTGCTTGATCTTCTCGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009288
VALIDATED
STK10 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 10
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009288.2-3341s21c1
Sequence:CCGGCACCGCGAACGCATCCTTATTCTCGAGAATAAGGATGCGTTCGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009288.2-1329s21c1
Sequence:CCGGCAAGAATGACAATGACTTAAACTCGAGTTTAAGTCATTGTCATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009288.2-2298s21c1
Sequence:CCGGCTGCGACAAGGAACGAGATTGCTCGAGCAATCTCGTTCCTTGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009288.2-3315s21c1
Sequence:CCGGGTGGGCACAAGCGCTACTAATCTCGAGATTAGTAGCGCTTGTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009288.2-396s21c1
Sequence:CCGGCACCTGTGACCACCCGTATATCTCGAGATATACGGGTGGTCACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009288.2-612s21c1
Sequence:CCGGGAAAGCTGGCAACGTGCTTATCTCGAGATAAGCACGTTGCCAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009288.1-147s1c1
Sequence:CCGGGAAGAGAAAGTCCCGTGAATACTCGAGTATTCACGGGACTTTCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009288.1-1550s1c1
Sequence:CCGGCGGACTGTAGCAATCTGTCTACTCGAGTAGACAGATTGCTACAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009288.1-2086s1c1
Sequence:CCGGGTGAAGAGTGAGGTTGAGAAACTCGAGTTTCTCAACCTCACTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009288.1-1620s1c1
Sequence:CCGGGAACAAAGAAACGGGCTCATTCTCGAGAATGAGCCCGTTTCTTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009288.1-2604s1c1
Sequence:CCGGGCGCGAGAAGATCAAGCAGTTCTCGAGAACTGCTTGATCTTCTCGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009288
VALIDATED
STK10 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 10
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009288.2-3341s21c1
Sequence:CCGGCACCGCGAACGCATCCTTATTCTCGAGAATAAGGATGCGTTCGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009288.2-1329s21c1
Sequence:CCGGCAAGAATGACAATGACTTAAACTCGAGTTTAAGTCATTGTCATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009288.2-2298s21c1
Sequence:CCGGCTGCGACAAGGAACGAGATTGCTCGAGCAATCTCGTTCCTTGTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009288.2-3315s21c1
Sequence:CCGGGTGGGCACAAGCGCTACTAATCTCGAGATTAGTAGCGCTTGTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009288.2-396s21c1
Sequence:CCGGCACCTGTGACCACCCGTATATCTCGAGATATACGGGTGGTCACAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009288.2-612s21c1
Sequence:CCGGGAAAGCTGGCAACGTGCTTATCTCGAGATAAGCACGTTGCCAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009288.1-147s1c1
Sequence:CCGGGAAGAGAAAGTCCCGTGAATACTCGAGTATTCACGGGACTTTCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009288.1-1550s1c1
Sequence:CCGGCGGACTGTAGCAATCTGTCTACTCGAGTAGACAGATTGCTACAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009288.1-2086s1c1
Sequence:CCGGGTGAAGAGTGAGGTTGAGAAACTCGAGTTTCTCAACCTCACTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009288.1-1620s1c1
Sequence:CCGGGAACAAAGAAACGGGCTCATTCTCGAGAATGAGCCCGTTTCTTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009288.1-2604s1c1
Sequence:CCGGGCGCGAGAAGATCAAGCAGTTCTCGAGAACTGCTTGATCTTCTCGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005990
VALIDATED
STK10 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 10
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005990.3-2120s21c1
Sequence:GTACCGGAGTTCTTTGACACGGAATTAGCTCGAGCTAATTCCGTGTCAAAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005990.3-1880s1c1
Sequence:CCGGTCAAGCGGACACGCAAATTTGCTCGAGCAAATTTGCGTGTCCGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005990.3-852s1c1
Sequence:CCGGGACTCTACAGAAACGAGATTCCTCGAGGAATCTCGTTTCTGTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005990.3-4621s21c1
Sequence:CCGGAGTAATCATGCGGGCATATTGCTCGAGCAATATGCCCGCATGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005990.3-2657s21c1
Sequence:CCGGGCTACAACCAGCGCATGATAGCTCGAGCTATCATGCGCTGGTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005990.3-1880s21c1
Sequence:CCGGTCAAGCGGACACGCAAATTTGCTCGAGCAAATTTGCGTGTCCGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005990.3-852s21c1
Sequence:CCGGGACTCTACAGAAACGAGATTCCTCGAGGAATCTCGTTTCTGTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005990.x-2724s1c1
Sequence:CCGGGTAGAGCACGAAACCCAGAAACTCGAGTTTCTGGGTTTCGTGCTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005990.x-3283s1c1
Sequence:CCGGAGTCCTCTCCTGTTTGCGAAACTCGAGTTTCGCAAACAGGAGAGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005990.x-860s1c1
Sequence:CCGGCCTGAAGATAGCCCTGGATAACTCGAGTTATCCAGGGCTATCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005990.x-1766s1c1
Sequence:CCGGCCAGAAAGAAGAGCATCGGAACTCGAGTTCCGATGCTCTTCTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005990.x-1847s1c1
Sequence:CCGGACAGGAAATCAACGCCAAGAACTCGAGTTCTTGGCGTTGATTTCCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005990.2-3632s1c1
Sequence:CCGGGCTCAGGAGATGGCCTCATTCCTCGAGGAATGAGGCCATCTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005990.2-2494s1c1
Sequence:CCGGGCAGCTCAAAGACCAGTACTTCTCGAGAAGTACTGGTCTTTGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005990.2-4182s1c1
Sequence:CCGGGCAGTCTGTTGGACTTCTCTTCTCGAGAAGAGAAGTCCAACAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005990
VALIDATED
STK10 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 10
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005990.3-2120s21c1
Sequence:GTACCGGAGTTCTTTGACACGGAATTAGCTCGAGCTAATTCCGTGTCAAAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005990.3-1880s1c1
Sequence:CCGGTCAAGCGGACACGCAAATTTGCTCGAGCAAATTTGCGTGTCCGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005990.3-852s1c1
Sequence:CCGGGACTCTACAGAAACGAGATTCCTCGAGGAATCTCGTTTCTGTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005990.3-4621s21c1
Sequence:CCGGAGTAATCATGCGGGCATATTGCTCGAGCAATATGCCCGCATGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005990.3-2657s21c1
Sequence:CCGGGCTACAACCAGCGCATGATAGCTCGAGCTATCATGCGCTGGTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005990.3-1880s21c1
Sequence:CCGGTCAAGCGGACACGCAAATTTGCTCGAGCAAATTTGCGTGTCCGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005990.3-852s21c1
Sequence:CCGGGACTCTACAGAAACGAGATTCCTCGAGGAATCTCGTTTCTGTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005990.x-2724s1c1
Sequence:CCGGGTAGAGCACGAAACCCAGAAACTCGAGTTTCTGGGTTTCGTGCTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005990.x-3283s1c1
Sequence:CCGGAGTCCTCTCCTGTTTGCGAAACTCGAGTTTCGCAAACAGGAGAGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005990.x-860s1c1
Sequence:CCGGCCTGAAGATAGCCCTGGATAACTCGAGTTATCCAGGGCTATCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005990.x-1766s1c1
Sequence:CCGGCCAGAAAGAAGAGCATCGGAACTCGAGTTCCGATGCTCTTCTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005990.x-1847s1c1
Sequence:CCGGACAGGAAATCAACGCCAAGAACTCGAGTTCTTGGCGTTGATTTCCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005990.2-3632s1c1
Sequence:CCGGGCTCAGGAGATGGCCTCATTCCTCGAGGAATGAGGCCATCTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005990.2-2494s1c1
Sequence:CCGGGCAGCTCAAAGACCAGTACTTCTCGAGAAGTACTGGTCTTTGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005990.2-4182s1c1
Sequence:CCGGGCAGTCTGTTGGACTTCTCTTCTCGAGAAGAGAAGTCCAACAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005990
VALIDATED
STK10 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 10
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005990.3-2120s21c1
Sequence:GTACCGGAGTTCTTTGACACGGAATTAGCTCGAGCTAATTCCGTGTCAAAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005990.3-1880s1c1
Sequence:CCGGTCAAGCGGACACGCAAATTTGCTCGAGCAAATTTGCGTGTCCGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005990.3-852s1c1
Sequence:CCGGGACTCTACAGAAACGAGATTCCTCGAGGAATCTCGTTTCTGTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005990.3-4621s21c1
Sequence:CCGGAGTAATCATGCGGGCATATTGCTCGAGCAATATGCCCGCATGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005990.3-2657s21c1
Sequence:CCGGGCTACAACCAGCGCATGATAGCTCGAGCTATCATGCGCTGGTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005990.3-1880s21c1
Sequence:CCGGTCAAGCGGACACGCAAATTTGCTCGAGCAAATTTGCGTGTCCGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005990.3-852s21c1
Sequence:CCGGGACTCTACAGAAACGAGATTCCTCGAGGAATCTCGTTTCTGTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005990.x-2724s1c1
Sequence:CCGGGTAGAGCACGAAACCCAGAAACTCGAGTTTCTGGGTTTCGTGCTCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005990.x-3283s1c1
Sequence:CCGGAGTCCTCTCCTGTTTGCGAAACTCGAGTTTCGCAAACAGGAGAGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005990.x-860s1c1
Sequence:CCGGCCTGAAGATAGCCCTGGATAACTCGAGTTATCCAGGGCTATCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005990.x-1766s1c1
Sequence:CCGGCCAGAAAGAAGAGCATCGGAACTCGAGTTCCGATGCTCTTCTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005990.x-1847s1c1
Sequence:CCGGACAGGAAATCAACGCCAAGAACTCGAGTTCTTGGCGTTGATTTCCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005990.2-3632s1c1
Sequence:CCGGGCTCAGGAGATGGCCTCATTCCTCGAGGAATGAGGCCATCTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_005990.2-2494s1c1
Sequence:CCGGGCAGCTCAAAGACCAGTACTTCTCGAGAAGTACTGGTCTTTGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005990.2-4182s1c1
Sequence:CCGGGCAGTCTGTTGGACTTCTCTTCTCGAGAAGAGAAGTCCAACAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks