EMAIL THIS PAGE TO A FRIEND

STK11

serine/threonine kinase 11

Synonyms: LKB1 PJS hLKB1
UniProtKB ID: Q15831, B2RBX7, E7EW76
Gene ID:
Human(6794) Summary: This gene, which encodes a member of the serine/threonine kinase family, regulates cell polarity and functions as a tumor suppressor. Mutations in this gene have been associated with Peutz-Jeghers syndrome, an autosomal dominant disorder characterized by the growth of polyps in the gastrointestinal tract, pigmented macules on the skin and mouth, and other neoplasms. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
Mouse(20869) serine/threonine kinase 11
Rat(314621) serine/threonine kinase 11
naked mole-rat(101707198) serine/threonine kinase 11
domestic guinea pig(100730854) serine/threonine kinase 11
cow(100337329) serine/threonine kinase 11
sheep(101117245) serine/threonine kinase 11
Zebrafish(550537) serine/threonine kinase 11
domestic cat(101085024) serine/threonine kinase 11
Horse(100055913) serine/threonine kinase 11
dog(485088) serine/threonine kinase 11
chicken(420105) serine/threonine kinase 11
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
L7917 Anti-LKB1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, rat
microarray, western blot pricing
SAB3500366 Anti-LKB1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB4502889 Anti-LKB1 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB4502890 Anti-LKB1 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB4502888 Anti-LKB1, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
immunofluorescence, immunohistochemistry pricing
SAB1304708 ANTI-MOUSE STK11 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4504034 Anti-phospho-LKB1 (pSer428) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301477 Anti-phospho-LKB1 (pSer428) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504035 Anti-phospho-LKB1 (pThr189) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4301525 Anti-phospho-LKB1 (pThr189) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
SAB1406494 Anti-STK11 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2107999 Anti-STK11 antibody produced in rabbit IgG fraction of antiserum mouse, guinea pig, horse, human, canine, bovine, rat, zebrafish
immunohistochemistry, western blot pricing
HPA017254 Anti-STK11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV41743 Anti-STK11 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder chicken, human, mouse, rat, horse, canine, zebrafish, bovine
immunohistochemistry, western blot pricing
HPA067481 Anti-STK11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
L9168 Monoclonal Anti-LKB1 antibody produced in mouse ~1 mg/mL, clone Ley37D/G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
WH0006794M1 Monoclonal Anti-STK11 antibody produced in mouse clone 2A7-H2, ascites fluid, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000455 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011492 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011492 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011492 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000455 Rosetta Predictions human pricing
NM_001108069 Rosetta Predictions rat pricing
NM_011492 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092687 predicted 1571
2 SASI_Hs01_00092688 predicted 1540
3 SASI_Hs01_00092689 predicted 1280
4 SASI_Hs01_00092690 predicted 1282
5 SASI_Hs01_00092691 predicted 1886
6 SASI_Hs01_00092692 predicted 1766
7 SASI_Hs01_00092693 predicted 1410
8 SASI_Hs01_00092694 predicted 2032
9 SASI_Hs01_00092695 predicted 1235
10 SASI_Hs01_00092696 predicted 1618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235044 predicted 1275
2 SASI_Rn02_00235045 predicted 1592
3 SASI_Rn02_00235046 predicted 2021
4 SASI_Rn02_00235047 predicted 1186
5 SASI_Rn02_00235048 predicted 1490
6 SASI_Rn02_00235049 predicted 986
7 SASI_Rn02_00235050 predicted 1662
8 SASI_Rn02_00235051 predicted 1318
9 SASI_Rn02_00235052 predicted 1713
10 SASI_Rn02_00235053 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079939 predicted 537
2 SASI_Mm01_00079940 predicted 808
3 SASI_Mm01_00079941 predicted 587
4 SASI_Mm01_00079942 predicted 468
5 SASI_Mm01_00079943 predicted 922
6 SASI_Mm01_00079944 predicted 557
7 SASI_Mm01_00079945 predicted 247
8 SASI_Mm01_00079946 predicted 970
9 SASI_Mm01_00079948 predicted 1138
10 SASI_Mm02_00320788 predicted 456
11 SASI_Mm01_00079947 predicted 1564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000455
VALIDATED
STK11 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000455.4-1242s1c1
Sequence:CCGGGCCAAGCTCATCGGCAAGTACCTCGAGGTACTTGCCGATGAGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000455.4-1160s1c1
Sequence:CCGGCGAGCTGATGTCGGTGGGTATCTCGAGATACCCACCGACATCAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000455.4-2280s1c1
Sequence:CCGGGCCGTGTGTATGAACGGCACACTCGAGTGTGCCGTTCATACACACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000455.4-1628s1c1
Sequence:CCGGCATTGTGCACAAGGACATCAACTCGAGTTGATGTCCTTGTGCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000455.x-2281s1c1
Sequence:CCGGGAGTGTGCGGTCAATATTTATCTCGAGATAAATATTGACCGCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000455.x-548s1c1
Sequence:CCGGGCCAACGTGAAGAAGGAAATTCTCGAGAATTTCCTTCTTCACGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000455.x-514s1c1
Sequence:CCGGGAAGAAGAAGTTGCGAAGGATCTCGAGATCCTTCGCAACTTCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000455.x-505s1c1
Sequence:CCGGGATCCTCAAGAAGAAGAAGTTCTCGAGAACTTCTTCTTCTTGAGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000455.x-1351s1c1
Sequence:CCGGCATCTACACTCAGGACTTCACCTCGAGGTGAAGTCCTGAGTGTAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000455
VALIDATED
STK11 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000455.4-1242s1c1
Sequence:CCGGGCCAAGCTCATCGGCAAGTACCTCGAGGTACTTGCCGATGAGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000455.4-1160s1c1
Sequence:CCGGCGAGCTGATGTCGGTGGGTATCTCGAGATACCCACCGACATCAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000455.4-2280s1c1
Sequence:CCGGGCCGTGTGTATGAACGGCACACTCGAGTGTGCCGTTCATACACACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000455.4-1628s1c1
Sequence:CCGGCATTGTGCACAAGGACATCAACTCGAGTTGATGTCCTTGTGCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000455.x-2281s1c1
Sequence:CCGGGAGTGTGCGGTCAATATTTATCTCGAGATAAATATTGACCGCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000455.x-548s1c1
Sequence:CCGGGCCAACGTGAAGAAGGAAATTCTCGAGAATTTCCTTCTTCACGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000455.x-514s1c1
Sequence:CCGGGAAGAAGAAGTTGCGAAGGATCTCGAGATCCTTCGCAACTTCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000455.x-505s1c1
Sequence:CCGGGATCCTCAAGAAGAAGAAGTTCTCGAGAACTTCTTCTTCTTGAGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000455.x-1351s1c1
Sequence:CCGGCATCTACACTCAGGACTTCACCTCGAGGTGAAGTCCTGAGTGTAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000455
VALIDATED
STK11 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000455.4-1242s1c1
Sequence:CCGGGCCAAGCTCATCGGCAAGTACCTCGAGGTACTTGCCGATGAGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000455.4-1160s1c1
Sequence:CCGGCGAGCTGATGTCGGTGGGTATCTCGAGATACCCACCGACATCAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000455.4-2280s1c1
Sequence:CCGGGCCGTGTGTATGAACGGCACACTCGAGTGTGCCGTTCATACACACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000455.4-1628s1c1
Sequence:CCGGCATTGTGCACAAGGACATCAACTCGAGTTGATGTCCTTGTGCACAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000455.x-2281s1c1
Sequence:CCGGGAGTGTGCGGTCAATATTTATCTCGAGATAAATATTGACCGCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000455.x-548s1c1
Sequence:CCGGGCCAACGTGAAGAAGGAAATTCTCGAGAATTTCCTTCTTCACGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000455.x-514s1c1
Sequence:CCGGGAAGAAGAAGTTGCGAAGGATCTCGAGATCCTTCGCAACTTCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000455.x-505s1c1
Sequence:CCGGGATCCTCAAGAAGAAGAAGTTCTCGAGAACTTCTTCTTCTTGAGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000455.x-1351s1c1
Sequence:CCGGCATCTACACTCAGGACTTCACCTCGAGGTGAAGTCCTGAGTGTAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011492
VALIDATED
STK11 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011492.1-1189s1c1
Sequence:CCGGGACAATATCTACAAGCTCTTTCTCGAGAAAGAGCTTGTAGATATTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011492.1-1585s1c1
Sequence:CCGGCCCAAGGCTGTTTGTGTGAATCTCGAGATTCACACAAACAGCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011492.1-736s1c1
Sequence:CCGGCATCGGAATGTGATCCAGCTTCTCGAGAAGCTGGATCACATTCCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011492.1-783s1c1
Sequence:CCGGGCAGAAGATGTATATGGTGATCTCGAGATCACCATATACATCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011492.1-543s1c1
Sequence:CCGGCGCCAAGCTCATCGGCAAGTACTCGAGTACTTGCCGATGAGCTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011492.3-854s21c4
Sequence:CCGGGACAATATCTACAAGCTCTTTCTCGAGAAAGAGCTTGTAGATATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011492.3-166s21c1
Sequence:CCGGCATCGACTCCACCGAGGTAATCTCGAGATTACCTCGGTGGAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011492.3-208s21c1
Sequence:CCGGCGCCAAGCTCATCGGCAAGTACTCGAGTACTTGCCGATGAGCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011492.3-1250s21c1
Sequence:CCGGCCCAAGGCTGTTTGTGTGAATCTCGAGATTCACACAAACAGCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011492.3-1394s21c1
Sequence:CCGGCTGAGGCCTACAGTGTGTCATCTCGAGATGACACACTGTAGGCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011492
VALIDATED
STK11 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011492.1-1189s1c1
Sequence:CCGGGACAATATCTACAAGCTCTTTCTCGAGAAAGAGCTTGTAGATATTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011492.1-1585s1c1
Sequence:CCGGCCCAAGGCTGTTTGTGTGAATCTCGAGATTCACACAAACAGCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011492.1-736s1c1
Sequence:CCGGCATCGGAATGTGATCCAGCTTCTCGAGAAGCTGGATCACATTCCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011492.1-783s1c1
Sequence:CCGGGCAGAAGATGTATATGGTGATCTCGAGATCACCATATACATCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011492.1-543s1c1
Sequence:CCGGCGCCAAGCTCATCGGCAAGTACTCGAGTACTTGCCGATGAGCTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011492.3-854s21c4
Sequence:CCGGGACAATATCTACAAGCTCTTTCTCGAGAAAGAGCTTGTAGATATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011492.3-166s21c1
Sequence:CCGGCATCGACTCCACCGAGGTAATCTCGAGATTACCTCGGTGGAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011492.3-208s21c1
Sequence:CCGGCGCCAAGCTCATCGGCAAGTACTCGAGTACTTGCCGATGAGCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011492.3-1250s21c1
Sequence:CCGGCCCAAGGCTGTTTGTGTGAATCTCGAGATTCACACAAACAGCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011492.3-1394s21c1
Sequence:CCGGCTGAGGCCTACAGTGTGTCATCTCGAGATGACACACTGTAGGCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011492
VALIDATED
STK11 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011492.1-1189s1c1
Sequence:CCGGGACAATATCTACAAGCTCTTTCTCGAGAAAGAGCTTGTAGATATTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011492.1-1585s1c1
Sequence:CCGGCCCAAGGCTGTTTGTGTGAATCTCGAGATTCACACAAACAGCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011492.1-736s1c1
Sequence:CCGGCATCGGAATGTGATCCAGCTTCTCGAGAAGCTGGATCACATTCCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011492.1-783s1c1
Sequence:CCGGGCAGAAGATGTATATGGTGATCTCGAGATCACCATATACATCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011492.1-543s1c1
Sequence:CCGGCGCCAAGCTCATCGGCAAGTACTCGAGTACTTGCCGATGAGCTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011492.3-854s21c4
Sequence:CCGGGACAATATCTACAAGCTCTTTCTCGAGAAAGAGCTTGTAGATATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011492.3-166s21c1
Sequence:CCGGCATCGACTCCACCGAGGTAATCTCGAGATTACCTCGGTGGAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011492.3-208s21c1
Sequence:CCGGCGCCAAGCTCATCGGCAAGTACTCGAGTACTTGCCGATGAGCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011492.3-1250s21c1
Sequence:CCGGCCCAAGGCTGTTTGTGTGAATCTCGAGATTCACACAAACAGCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011492.3-1394s21c1
Sequence:CCGGCTGAGGCCTACAGTGTGTCATCTCGAGATGACACACTGTAGGCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks