EMAIL THIS PAGE TO A FRIEND

STK11IP

serine/threonine kinase 11 interacting protein

Synonyms: LIP1 LKB1IP STK11IP1
UniProtKB ID: Q8N1F8, Q8NAW9, Q8WXE4, Q96CN3, Q96PY9
Gene ID:
Mouse(71728) serine/threonine kinase 11 interacting protein
Rat(301535) serine/threonine kinase 11 interacting protein
Zebrafish(795019) serine/threonine kinase 11 interacting protein
Horse(100059685) serine/threonine kinase 11 interacting protein
domestic cat(101080729) serine/threonine kinase 11 interacting protein
dog(488541) serine/threonine kinase 11 interacting protein
chicken(424195) serine/threonine kinase 11 interacting protein
cow(515395) serine/threonine kinase 11 interacting protein
sheep(101115102) serine/threonine kinase 11 interacting protein
domestic guinea pig(100720590) serine/threonine kinase 11 interacting protein
naked mole-rat(101707191) serine/threonine kinase 11 interacting protein
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052902 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052902 Rosetta Predictions human pricing
NM_001106922 Rosetta Predictions rat pricing
NM_027886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361642 predicted 1950
2 SASI_Hs02_00361643 predicted 1228
3 SASI_Hs01_00031559 predicted 2951
4 SASI_Hs02_00361644 predicted 1907
5 SASI_Hs01_00031560 predicted 639
6 SASI_Hs01_00031561 predicted 2028
7 SASI_Hs02_00361645 predicted 594
8 SASI_Hs02_00361646 predicted 2895
9 SASI_Hs02_00361647 predicted 2755
10 SASI_Hs02_00361648 predicted 817
11 SASI_Hs01_00031558 predicted 730
12 SASI_Hs01_00031562 predicted 2131
13 SASI_Hs01_00031563 predicted 734
14 SASI_Hs01_00031564 predicted 1118
15 SASI_Hs01_00031565 predicted 458
16 SASI_Hs01_00031566 predicted 842
17 SASI_Hs01_00031567 predicted 2997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223726 predicted 2041
2 SASI_Rn02_00223727 predicted 875
3 SASI_Rn02_00223728 predicted 942
4 SASI_Rn02_00223729 predicted 3108
5 SASI_Rn02_00223730 predicted 2698
6 SASI_Rn02_00223731 predicted 3321
7 SASI_Rn02_00223732 predicted 2404
8 SASI_Rn02_00223733 predicted 3104
9 SASI_Rn02_00223734 predicted 859
10 SASI_Rn02_00223735 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332847 predicted 771
2 SASI_Mm02_00332848 predicted 3169
3 SASI_Mm02_00332849 predicted 3006
4 SASI_Mm02_00332850 predicted 2515
5 SASI_Mm02_00332851 predicted 398
6 SASI_Mm02_00332852 predicted 1205
7 SASI_Mm02_00332853 predicted 1940
8 SASI_Mm02_00332854 predicted 844
9 SASI_Mm02_00332855 predicted 860
10 SASI_Mm02_00332856 predicted 916
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027886
VALIDATED
STK11IP MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 11 interacting protein
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027886.3-3582s21c1
Sequence:CCGGCTTACTCTCAGGTATCAATAACTCGAGTTATTGATACCTGAGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-3310s21c1
Sequence:CCGGCATTGGACTCCGGACAGTAACCTCGAGGTTACTGTCCGGAGTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-761s21c1
Sequence:CCGGTTATGTGAGCTGTACCATTTGCTCGAGCAAATGGTACAGCTCACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-1553s21c1
Sequence:CCGGGCCATAGAGGACGACACTAAGCTCGAGCTTAGTGTCGTCCTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-911s21c1
Sequence:CCGGCATCTCGATGTGGCCTATAACCTCGAGGTTATAGGCCACATCGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-2373s21c1
Sequence:CCGGTCCCACCTCAGACATCCATATCTCGAGATATGGATGTCTGAGGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027886.3-3808s21c1
Sequence:CCGGCAATTAGTTGGGTCCCTTAAGCTCGAGCTTAAGGGACCCAACTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-2996s21c1
Sequence:CCGGTTGTCCACCCTGTACCTATTACTCGAGTAATAGGTACAGGGTGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027886.2-3922s1c1
Sequence:CCGGGCCTTCTAAGTGTTGAGATTACTCGAGTAATCTCAACACTTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027886.2-758s1c1
Sequence:CCGGCCATTTGGACATCTCCTATAACTCGAGTTATAGGAGATGTCCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027886.2-2573s1c1
Sequence:CCGGCCACATGCTTTACCTGTTGAACTCGAGTTCAACAGGTAAAGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027886.2-1782s1c1
Sequence:CCGGGCCCACTTGTTTGAAGTGGAACTCGAGTTCCACTTCAAACAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027886
VALIDATED
STK11IP MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 11 interacting protein
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027886.3-3582s21c1
Sequence:CCGGCTTACTCTCAGGTATCAATAACTCGAGTTATTGATACCTGAGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-3310s21c1
Sequence:CCGGCATTGGACTCCGGACAGTAACCTCGAGGTTACTGTCCGGAGTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-761s21c1
Sequence:CCGGTTATGTGAGCTGTACCATTTGCTCGAGCAAATGGTACAGCTCACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-1553s21c1
Sequence:CCGGGCCATAGAGGACGACACTAAGCTCGAGCTTAGTGTCGTCCTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-911s21c1
Sequence:CCGGCATCTCGATGTGGCCTATAACCTCGAGGTTATAGGCCACATCGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-2373s21c1
Sequence:CCGGTCCCACCTCAGACATCCATATCTCGAGATATGGATGTCTGAGGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027886.3-3808s21c1
Sequence:CCGGCAATTAGTTGGGTCCCTTAAGCTCGAGCTTAAGGGACCCAACTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-2996s21c1
Sequence:CCGGTTGTCCACCCTGTACCTATTACTCGAGTAATAGGTACAGGGTGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027886.2-3922s1c1
Sequence:CCGGGCCTTCTAAGTGTTGAGATTACTCGAGTAATCTCAACACTTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027886.2-758s1c1
Sequence:CCGGCCATTTGGACATCTCCTATAACTCGAGTTATAGGAGATGTCCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027886.2-2573s1c1
Sequence:CCGGCCACATGCTTTACCTGTTGAACTCGAGTTCAACAGGTAAAGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027886.2-1782s1c1
Sequence:CCGGGCCCACTTGTTTGAAGTGGAACTCGAGTTCCACTTCAAACAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027886
VALIDATED
STK11IP MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 11 interacting protein
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027886.3-3582s21c1
Sequence:CCGGCTTACTCTCAGGTATCAATAACTCGAGTTATTGATACCTGAGAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-3310s21c1
Sequence:CCGGCATTGGACTCCGGACAGTAACCTCGAGGTTACTGTCCGGAGTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-761s21c1
Sequence:CCGGTTATGTGAGCTGTACCATTTGCTCGAGCAAATGGTACAGCTCACATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-1553s21c1
Sequence:CCGGGCCATAGAGGACGACACTAAGCTCGAGCTTAGTGTCGTCCTCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-911s21c1
Sequence:CCGGCATCTCGATGTGGCCTATAACCTCGAGGTTATAGGCCACATCGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-2373s21c1
Sequence:CCGGTCCCACCTCAGACATCCATATCTCGAGATATGGATGTCTGAGGTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027886.3-3808s21c1
Sequence:CCGGCAATTAGTTGGGTCCCTTAAGCTCGAGCTTAAGGGACCCAACTAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027886.3-2996s21c1
Sequence:CCGGTTGTCCACCCTGTACCTATTACTCGAGTAATAGGTACAGGGTGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027886.2-3922s1c1
Sequence:CCGGGCCTTCTAAGTGTTGAGATTACTCGAGTAATCTCAACACTTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027886.2-758s1c1
Sequence:CCGGCCATTTGGACATCTCCTATAACTCGAGTTATAGGAGATGTCCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027886.2-2573s1c1
Sequence:CCGGCCACATGCTTTACCTGTTGAACTCGAGTTCAACAGGTAAAGCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027886.2-1782s1c1
Sequence:CCGGGCCCACTTGTTTGAAGTGGAACTCGAGTTCCACTTCAAACAAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052902
VALIDATED
STK11IP MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 11 interacting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052902.2-3427s21c1
Sequence:CCGGCTCTGGCTGTGGATGTCTTCACTCGAGTGAAGACATCCACAGCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052902.2-287s21c1
Sequence:CCGGGTTATTCTTCAGCTTCAGTTTCTCGAGAAACTGAAGCTGAAGAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052902.2-635s21c1
Sequence:CCGGGCTCTGCGTTTCTTGAACCTACTCGAGTAGGTTCAAGAAACGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052902.2-714s21c1
Sequence:CCGGATCTGGACATCTCCTATAATCCTCGAGGATTATAGGAGATGTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052902.2-1236s21c1
Sequence:CCGGGCATCTCTGAACCCAGTGATACTCGAGTATCACTGGGTTCAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052902.1-3471s1c1
Sequence:CCGGGTCCCAAATGACCCAGGGCTTCTCGAGAAGCCCTGGGTCATTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052902.1-287s1c1
Sequence:CCGGGTTATTCTTCAGCTTCAGTTTCTCGAGAAACTGAAGCTGAAGAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_052902.1-847s1c1
Sequence:CCGGGCACCTGGATTTGGCATACAACTCGAGTTGTATGCCAAATCCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_052902.1-635s1c1
Sequence:CCGGGCTCTGCGTTTCTTGAACCTACTCGAGTAGGTTCAAGAAACGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_052902.1-1236s1c1
Sequence:CCGGGCATCTCTGAACCCAGTGATACTCGAGTATCACTGGGTTCAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052902
VALIDATED
STK11IP MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 11 interacting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052902.2-3427s21c1
Sequence:CCGGCTCTGGCTGTGGATGTCTTCACTCGAGTGAAGACATCCACAGCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052902.2-287s21c1
Sequence:CCGGGTTATTCTTCAGCTTCAGTTTCTCGAGAAACTGAAGCTGAAGAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052902.2-635s21c1
Sequence:CCGGGCTCTGCGTTTCTTGAACCTACTCGAGTAGGTTCAAGAAACGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052902.2-714s21c1
Sequence:CCGGATCTGGACATCTCCTATAATCCTCGAGGATTATAGGAGATGTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052902.2-1236s21c1
Sequence:CCGGGCATCTCTGAACCCAGTGATACTCGAGTATCACTGGGTTCAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052902.1-3471s1c1
Sequence:CCGGGTCCCAAATGACCCAGGGCTTCTCGAGAAGCCCTGGGTCATTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052902.1-287s1c1
Sequence:CCGGGTTATTCTTCAGCTTCAGTTTCTCGAGAAACTGAAGCTGAAGAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_052902.1-847s1c1
Sequence:CCGGGCACCTGGATTTGGCATACAACTCGAGTTGTATGCCAAATCCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_052902.1-635s1c1
Sequence:CCGGGCTCTGCGTTTCTTGAACCTACTCGAGTAGGTTCAAGAAACGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_052902.1-1236s1c1
Sequence:CCGGGCATCTCTGAACCCAGTGATACTCGAGTATCACTGGGTTCAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052902
VALIDATED
STK11IP MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 11 interacting protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052902.2-3427s21c1
Sequence:CCGGCTCTGGCTGTGGATGTCTTCACTCGAGTGAAGACATCCACAGCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052902.2-287s21c1
Sequence:CCGGGTTATTCTTCAGCTTCAGTTTCTCGAGAAACTGAAGCTGAAGAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052902.2-635s21c1
Sequence:CCGGGCTCTGCGTTTCTTGAACCTACTCGAGTAGGTTCAAGAAACGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052902.2-714s21c1
Sequence:CCGGATCTGGACATCTCCTATAATCCTCGAGGATTATAGGAGATGTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052902.2-1236s21c1
Sequence:CCGGGCATCTCTGAACCCAGTGATACTCGAGTATCACTGGGTTCAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052902.1-3471s1c1
Sequence:CCGGGTCCCAAATGACCCAGGGCTTCTCGAGAAGCCCTGGGTCATTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052902.1-287s1c1
Sequence:CCGGGTTATTCTTCAGCTTCAGTTTCTCGAGAAACTGAAGCTGAAGAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_052902.1-847s1c1
Sequence:CCGGGCACCTGGATTTGGCATACAACTCGAGTTGTATGCCAAATCCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_052902.1-635s1c1
Sequence:CCGGGCTCTGCGTTTCTTGAACCTACTCGAGTAGGTTCAAGAAACGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_052902.1-1236s1c1
Sequence:CCGGGCATCTCTGAACCCAGTGATACTCGAGTATCACTGGGTTCAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks