EMAIL THIS PAGE TO A FRIEND

STK16

serine/threonine kinase 16

Synonyms: KRCT MPSK PKL12 TSF1
Gene ID:
Mouse(20872) serine/threonine kinase 16
Rat(286927) serine/threonine kinase 16
naked mole-rat(101722400) serine/threonine kinase 16
domestic guinea pig(100735063) serine/threonine kinase 16
cow(521237) serine/threonine kinase 16
sheep(101113048) serine/threonine kinase 16
Goat(100861158) serine/threonine kinase 16
Zebrafish(550323) serine/threonine kinase 16
chicken(429036) serine/threonine kinase 16
dog(488536) serine/threonine kinase 16
domestic cat(101095674) serine/threonine kinase 16
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003691 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011494 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011494 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011494 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008910 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158141 MISSION® esiRNA esiRNA human STK16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008910 Rosetta Predictions human pricing
NM_003691 siRNAs that have been validated in the lab human pricing
NM_173142 Rosetta Predictions rat pricing
NM_011494 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243522 predicted 258
2 SASI_Hs01_00243523 predicted 603
3 SASI_Hs01_00243524 predicted 978
4 SASI_Hs01_00243525 predicted 751
5 SASI_Hs01_00243526 predicted 824
6 SASI_Hs01_00243527 predicted 648
7 SASI_Hs01_00243528 predicted 353
8 SASI_Hs01_00243529 predicted 271
9 SASI_Hs01_00243530 predicted 281
10 SASI_Hs01_00243531 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003691 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045978 validated 498
2 SASI_Hs01_00045979 predicted 1440
3 SASI_Hs02_00336114 predicted 851
4 SASI_Hs01_00045980 predicted 1225
5 SASI_Hs01_00045981 predicted 1295
6 SASI_Hs01_00045983 predicted 1067
7 SASI_Hs01_00045984 predicted 893
8 SASI_Hs01_00045985 predicted 590
9 SASI_Hs01_00045986 predicted 512
10 SASI_Hs01_00045987 predicted 526
11 SASI_Hs01_00045982 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070183 predicted 941
2 SASI_Rn02_00269323 predicted 515
3 SASI_Rn01_00070184 predicted 517
4 SASI_Rn01_00070185 predicted 383
5 SASI_Rn02_00269324 predicted 642
6 SASI_Rn01_00070186 predicted 867
7 SASI_Rn01_00070187 predicted 624
8 SASI_Rn01_00070189 predicted 1060
9 SASI_Rn01_00070190 predicted 388
10 SASI_Rn01_00070192 predicted 393
11 SASI_Rn01_00070188 predicted 661
12 SASI_Rn01_00070191 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145252 predicted 978
2 SASI_Mm01_00145253 predicted 1079
3 SASI_Mm01_00145254 predicted 337
4 SASI_Mm01_00145256 predicted 1256
5 SASI_Mm02_00320789 predicted 1188
6 SASI_Mm01_00145257 predicted 1303
7 SASI_Mm01_00145259 predicted 690
8 SASI_Mm01_00145260 predicted 956
9 SASI_Mm02_00320790 predicted 694
10 SASI_Mm02_00320791 predicted 784
11 SASI_Mm01_00145255 predicted 1065
12 SASI_Mm01_00145258 predicted 1248
13 SASI_Mm01_00145261 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003691
VALIDATED
STK16 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 16
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003691.2-1175s1c1
Sequence:CCGGCCAGGCATTCTTCAGCATTGCCTCGAGGCAATGCTGAAGAATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003691.2-489s1c1
Sequence:CCGGGTTCAGCTATGTGGACCTAGTCTCGAGACTAGGTCCACATAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003691.x-1331s1c1
Sequence:CCGGGAGCAGGAGAATGTGTAACAACTCGAGTTGTTACACATTCTCCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003691.x-224s1c1
Sequence:CCGGCTAGTGGAAGGGTTACATGATCTCGAGATCATGTAACCCTTCCACTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003691.x-427s1c1
Sequence:CCGGAGGTACGCTGTGGAATGAGATCTCGAGATCTCATTCCACAGCGTACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003691.x-784s1c1
Sequence:CCGGCTGCGTGCTATATGCCATGATCTCGAGATCATGGCATATAGCACGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003691.x-403s1c1
Sequence:CCGGGCTGCTGCTACCATTCTTCAACTCGAGTTGAAGAATGGTAGCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003691
VALIDATED
STK16 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 16
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003691.2-1175s1c1
Sequence:CCGGCCAGGCATTCTTCAGCATTGCCTCGAGGCAATGCTGAAGAATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003691.2-489s1c1
Sequence:CCGGGTTCAGCTATGTGGACCTAGTCTCGAGACTAGGTCCACATAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003691.x-1331s1c1
Sequence:CCGGGAGCAGGAGAATGTGTAACAACTCGAGTTGTTACACATTCTCCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003691.x-224s1c1
Sequence:CCGGCTAGTGGAAGGGTTACATGATCTCGAGATCATGTAACCCTTCCACTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003691.x-427s1c1
Sequence:CCGGAGGTACGCTGTGGAATGAGATCTCGAGATCTCATTCCACAGCGTACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003691.x-784s1c1
Sequence:CCGGCTGCGTGCTATATGCCATGATCTCGAGATCATGGCATATAGCACGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003691.x-403s1c1
Sequence:CCGGGCTGCTGCTACCATTCTTCAACTCGAGTTGAAGAATGGTAGCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003691
VALIDATED
STK16 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 16
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003691.2-1175s1c1
Sequence:CCGGCCAGGCATTCTTCAGCATTGCCTCGAGGCAATGCTGAAGAATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003691.2-489s1c1
Sequence:CCGGGTTCAGCTATGTGGACCTAGTCTCGAGACTAGGTCCACATAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003691.x-1331s1c1
Sequence:CCGGGAGCAGGAGAATGTGTAACAACTCGAGTTGTTACACATTCTCCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003691.x-224s1c1
Sequence:CCGGCTAGTGGAAGGGTTACATGATCTCGAGATCATGTAACCCTTCCACTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003691.x-427s1c1
Sequence:CCGGAGGTACGCTGTGGAATGAGATCTCGAGATCTCATTCCACAGCGTACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003691.x-784s1c1
Sequence:CCGGCTGCGTGCTATATGCCATGATCTCGAGATCATGGCATATAGCACGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003691.x-403s1c1
Sequence:CCGGGCTGCTGCTACCATTCTTCAACTCGAGTTGAAGAATGGTAGCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011494
VALIDATED
STK16 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 16
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011494.2-931s1c1
Sequence:CCGGCGGACTGATGTCTGGTCCCTACTCGAGTAGGGACCAGACATCAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011494.2-1083s1c1
Sequence:CCGGGCGACAGCTATTGTCTTCTATCTCGAGATAGAAGACAATAGCTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011494.2-327s1c1
Sequence:CCGGCATCATTGACAATAAGCGTTACTCGAGTAACGCTTATTGTCAATGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011494.2-700s1c1
Sequence:CCGGGCTATTCATGCCAAAGGTTATCTCGAGATAACCTTTGGCATGAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011494.2-539s1c1
Sequence:CCGGCTCTGAAAGAACGAGGTGCTACTCGAGTAGCACCTCGTTCTTTCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011494.3-1306s21c1
Sequence:CCGGAGGATAGTGGGTCCTTGTATACTCGAGTATACAAGGACCCACTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011494.3-326s21c1
Sequence:CCGGCATCATTGACAATAAGCGTTACTCGAGTAACGCTTATTGTCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011494.3-538s21c1
Sequence:CCGGCTCTGAAAGAACGAGGTGCTACTCGAGTAGCACCTCGTTCTTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011494.3-1082s21c1
Sequence:CCGGGCGACAGCTATTGTCTTCTATCTCGAGATAGAAGACAATAGCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011494.4-1556s21c1
Sequence:CCGGTGAACTCTCTGCTTGCTATTTCTCGAGAAATAGCAAGCAGAGAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011494.5-725s21c1
Sequence:CCGGGCTATTCATGCCAAAGGTTATCTCGAGATAACCTTTGGCATGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011494
VALIDATED
STK16 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 16
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011494.2-931s1c1
Sequence:CCGGCGGACTGATGTCTGGTCCCTACTCGAGTAGGGACCAGACATCAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011494.2-1083s1c1
Sequence:CCGGGCGACAGCTATTGTCTTCTATCTCGAGATAGAAGACAATAGCTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011494.2-327s1c1
Sequence:CCGGCATCATTGACAATAAGCGTTACTCGAGTAACGCTTATTGTCAATGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011494.2-700s1c1
Sequence:CCGGGCTATTCATGCCAAAGGTTATCTCGAGATAACCTTTGGCATGAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011494.2-539s1c1
Sequence:CCGGCTCTGAAAGAACGAGGTGCTACTCGAGTAGCACCTCGTTCTTTCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011494.3-1306s21c1
Sequence:CCGGAGGATAGTGGGTCCTTGTATACTCGAGTATACAAGGACCCACTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011494.3-326s21c1
Sequence:CCGGCATCATTGACAATAAGCGTTACTCGAGTAACGCTTATTGTCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011494.3-538s21c1
Sequence:CCGGCTCTGAAAGAACGAGGTGCTACTCGAGTAGCACCTCGTTCTTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011494.3-1082s21c1
Sequence:CCGGGCGACAGCTATTGTCTTCTATCTCGAGATAGAAGACAATAGCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011494.4-1556s21c1
Sequence:CCGGTGAACTCTCTGCTTGCTATTTCTCGAGAAATAGCAAGCAGAGAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011494.5-725s21c1
Sequence:CCGGGCTATTCATGCCAAAGGTTATCTCGAGATAACCTTTGGCATGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011494
VALIDATED
STK16 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 16
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011494.2-931s1c1
Sequence:CCGGCGGACTGATGTCTGGTCCCTACTCGAGTAGGGACCAGACATCAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011494.2-1083s1c1
Sequence:CCGGGCGACAGCTATTGTCTTCTATCTCGAGATAGAAGACAATAGCTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011494.2-327s1c1
Sequence:CCGGCATCATTGACAATAAGCGTTACTCGAGTAACGCTTATTGTCAATGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011494.2-700s1c1
Sequence:CCGGGCTATTCATGCCAAAGGTTATCTCGAGATAACCTTTGGCATGAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011494.2-539s1c1
Sequence:CCGGCTCTGAAAGAACGAGGTGCTACTCGAGTAGCACCTCGTTCTTTCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011494.3-1306s21c1
Sequence:CCGGAGGATAGTGGGTCCTTGTATACTCGAGTATACAAGGACCCACTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011494.3-326s21c1
Sequence:CCGGCATCATTGACAATAAGCGTTACTCGAGTAACGCTTATTGTCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011494.3-538s21c1
Sequence:CCGGCTCTGAAAGAACGAGGTGCTACTCGAGTAGCACCTCGTTCTTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011494.3-1082s21c1
Sequence:CCGGGCGACAGCTATTGTCTTCTATCTCGAGATAGAAGACAATAGCTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011494.4-1556s21c1
Sequence:CCGGTGAACTCTCTGCTTGCTATTTCTCGAGAAATAGCAAGCAGAGAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011494.5-725s21c1
Sequence:CCGGGCTATTCATGCCAAAGGTTATCTCGAGATAACCTTTGGCATGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008910
STK16 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 16
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008910.2-1409s21c1
Sequence:CCGGGCAGGTTGGTGTAGATCTTAGCTCGAGCTAAGATCTACACCAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008910.2-599s21c1
Sequence:CCGGGACTTGAAGCCCACCAATATACTCGAGTATATTGGTGGGCTTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008910.2-651s21c1
Sequence:CCGGTGGACTTGGGTTCCATGAATCCTCGAGGATTCATGGAACCCAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008910.2-1349s21c1
Sequence:CCGGCATAGTGTTCTGACTCCAAATCTCGAGATTTGGAGTCAGAACACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008910.2-1380s21c1
Sequence:CCGGGAGAATGTGTAAACAAGAATACTCGAGTATTCTTGTTTACACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008910
STK16 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 16
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008910.2-1409s21c1
Sequence:CCGGGCAGGTTGGTGTAGATCTTAGCTCGAGCTAAGATCTACACCAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008910.2-599s21c1
Sequence:CCGGGACTTGAAGCCCACCAATATACTCGAGTATATTGGTGGGCTTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008910.2-651s21c1
Sequence:CCGGTGGACTTGGGTTCCATGAATCCTCGAGGATTCATGGAACCCAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008910.2-1349s21c1
Sequence:CCGGCATAGTGTTCTGACTCCAAATCTCGAGATTTGGAGTCAGAACACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008910.2-1380s21c1
Sequence:CCGGGAGAATGTGTAAACAAGAATACTCGAGTATTCTTGTTTACACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008910
STK16 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 16
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008910.2-1409s21c1
Sequence:CCGGGCAGGTTGGTGTAGATCTTAGCTCGAGCTAAGATCTACACCAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008910.2-599s21c1
Sequence:CCGGGACTTGAAGCCCACCAATATACTCGAGTATATTGGTGGGCTTCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008910.2-651s21c1
Sequence:CCGGTGGACTTGGGTTCCATGAATCCTCGAGGATTCATGGAACCCAAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008910.2-1349s21c1
Sequence:CCGGCATAGTGTTCTGACTCCAAATCTCGAGATTTGGAGTCAGAACACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008910.2-1380s21c1
Sequence:CCGGGAGAATGTGTAAACAAGAATACTCGAGTATTCTTGTTTACACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks