EMAIL THIS PAGE TO A FRIEND

STK17A

serine/threonine kinase 17a

Synonyms: DRAK1
UniProtKB ID: Q9UEE5, A4D1V6, Q8IVC8
Gene ID:
Human(9263) Summary: This gene is a member of the DAP kinase-related apoptosis-inducing protein kinase family and encodes an autophosphorylated nuclear protein with a protein kinase domain. The protein has apoptosis-inducing activity. [provided by RefSeq, Jul 2008]
Zebrafish(327345) serine/threonine kinase 17a
chicken(420775) serine/threonine kinase 17a
dog(483241) serine/threonine kinase 17a
domestic cat(101089252) serine/threonine kinase 17a
cow(513665) serine/threonine kinase 17a
sheep(101119390) serine/threonine kinase 17a
domestic guinea pig(100721984) serine/threonine kinase 17a
naked mole-rat(101700846) serine/threonine kinase 17a
Domestic Rabbit(100008622) serine/threonine kinase 17a
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS2147 Anti-DRAK1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
D1314 Anti-DRAK1 antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
microarray, western blot pricing
SAB1306035 ANTI-DRAK1(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB2102325 Anti-STK17A antibody produced in rabbit affinity isolated antibody rabbit, horse, human, bovine, guinea pig
western blot pricing
HPA037979 Anti-STK17A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1411635 Anti-STK17A antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA018138 Anti-STK17A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
WH0009263M3 Monoclonal Anti-STK17A antibody produced in mouse clone 4D12, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, western blot pricing
SAB1404697 Monoclonal Anti-STK17A, (C-terminal) antibody produced in mouse clone 3G8, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004760 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004760 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004760 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018811 MISSION® esiRNA esiRNA targeting human STK17A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004760 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338248 predicted 1404
2 SASI_Hs01_00136992 predicted 738
3 SASI_Hs01_00136993 predicted 1360
4 SASI_Hs01_00136994 predicted 852
5 SASI_Hs01_00136997 predicted 949
6 SASI_Hs01_00136998 predicted 637
7 SASI_Hs01_00136999 predicted 1279
8 SASI_Hs01_00137000 predicted 507
9 SASI_Hs01_00137001 predicted 722
10 SASI_Hs02_00338249 predicted 543
11 SASI_Hs01_00136995 predicted 687
12 SASI_Hs01_00136996 predicted 873
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004760
VALIDATED
STK17A MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 17a
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004760.2-500s21c1
Sequence:GTACCGGGACAATCCTTGGGTCATTAATCTCGAGATTAATGACCCAAGGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004760.2-1327s21c1
Sequence:CCGGGGCCATTTCCAAACGATTTAACTCGAGTTAAATCGTTTGGAAATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004760.2-473s21c1
Sequence:CCGGGAGATTGCTGTACTTGAACTACTCGAGTAGTTCAAGTACAGCAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004760.2-799s21c1
Sequence:CCGGCAGTGAAGAGCTCCGAGAAATCTCGAGATTTCTCGGAGCTCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004760.2-853s21c1
Sequence:GTACCGGTCTTAGTTATGATCCTATAAGCTCGAGCTTATAGGATCATAACTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004760.2-1594s21c1
Sequence:GTACCGGAGTTACCCGTTTCAATGTTATCTCGAGATAACATTGAAACGGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004760.2-1118s21c1
Sequence:CCGGCAGAGCAGTATTCAAGAGCCTCTCGAGAGGCTCTTGAATACTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004760.2-1488s21c1
Sequence:CCGGTGGATAACCAGTATCACTTACCTCGAGGTAAGTGATACTGGTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004760.x-854s1c1
Sequence:CCGGTGTGGAGCATTGGAGTGTTAACTCGAGTTAACACTCCAATGCTCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004760.x-1998s1c1
Sequence:CCGGCTAGTAAGAGAGGTGGTAATTCTCGAGAATTACCACCTCTCTTACTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004760.x-832s1c1
Sequence:CCGGCCTATAAGCATGGCAACAGATCTCGAGATCTGTTGCCATGCTTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004760.x-1084s1c1
Sequence:CCGGCAGAGCAGTATTCAAGAGCCTCTCGAGAGGCTCTTGAATACTGCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004760.x-439s1c1
Sequence:CCGGGAGATTGCTGTACTTGAACTACTCGAGTAGTTCAAGTACAGCAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194941    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004760.2-3644s1c1
Sequence:CCGGCTATTGAGTTTACTCGGTTTACTCGAGTAAACCGAGTAAACTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004760
VALIDATED
STK17A MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 17a
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004760.2-500s21c1
Sequence:GTACCGGGACAATCCTTGGGTCATTAATCTCGAGATTAATGACCCAAGGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004760.2-1327s21c1
Sequence:CCGGGGCCATTTCCAAACGATTTAACTCGAGTTAAATCGTTTGGAAATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004760.2-473s21c1
Sequence:CCGGGAGATTGCTGTACTTGAACTACTCGAGTAGTTCAAGTACAGCAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004760.2-799s21c1
Sequence:CCGGCAGTGAAGAGCTCCGAGAAATCTCGAGATTTCTCGGAGCTCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004760.2-853s21c1
Sequence:GTACCGGTCTTAGTTATGATCCTATAAGCTCGAGCTTATAGGATCATAACTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004760.2-1594s21c1
Sequence:GTACCGGAGTTACCCGTTTCAATGTTATCTCGAGATAACATTGAAACGGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004760.2-1118s21c1
Sequence:CCGGCAGAGCAGTATTCAAGAGCCTCTCGAGAGGCTCTTGAATACTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004760.2-1488s21c1
Sequence:CCGGTGGATAACCAGTATCACTTACCTCGAGGTAAGTGATACTGGTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004760.x-854s1c1
Sequence:CCGGTGTGGAGCATTGGAGTGTTAACTCGAGTTAACACTCCAATGCTCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004760.x-1998s1c1
Sequence:CCGGCTAGTAAGAGAGGTGGTAATTCTCGAGAATTACCACCTCTCTTACTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004760.x-832s1c1
Sequence:CCGGCCTATAAGCATGGCAACAGATCTCGAGATCTGTTGCCATGCTTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004760.x-1084s1c1
Sequence:CCGGCAGAGCAGTATTCAAGAGCCTCTCGAGAGGCTCTTGAATACTGCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004760.x-439s1c1
Sequence:CCGGGAGATTGCTGTACTTGAACTACTCGAGTAGTTCAAGTACAGCAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194941    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004760.2-3644s1c1
Sequence:CCGGCTATTGAGTTTACTCGGTTTACTCGAGTAAACCGAGTAAACTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004760
VALIDATED
STK17A MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 17a
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004760.2-500s21c1
Sequence:GTACCGGGACAATCCTTGGGTCATTAATCTCGAGATTAATGACCCAAGGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004760.2-1327s21c1
Sequence:CCGGGGCCATTTCCAAACGATTTAACTCGAGTTAAATCGTTTGGAAATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004760.2-473s21c1
Sequence:CCGGGAGATTGCTGTACTTGAACTACTCGAGTAGTTCAAGTACAGCAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004760.2-799s21c1
Sequence:CCGGCAGTGAAGAGCTCCGAGAAATCTCGAGATTTCTCGGAGCTCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004760.2-853s21c1
Sequence:GTACCGGTCTTAGTTATGATCCTATAAGCTCGAGCTTATAGGATCATAACTAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004760.2-1594s21c1
Sequence:GTACCGGAGTTACCCGTTTCAATGTTATCTCGAGATAACATTGAAACGGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004760.2-1118s21c1
Sequence:CCGGCAGAGCAGTATTCAAGAGCCTCTCGAGAGGCTCTTGAATACTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004760.2-1488s21c1
Sequence:CCGGTGGATAACCAGTATCACTTACCTCGAGGTAAGTGATACTGGTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004760.x-854s1c1
Sequence:CCGGTGTGGAGCATTGGAGTGTTAACTCGAGTTAACACTCCAATGCTCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004760.x-1998s1c1
Sequence:CCGGCTAGTAAGAGAGGTGGTAATTCTCGAGAATTACCACCTCTCTTACTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004760.x-832s1c1
Sequence:CCGGCCTATAAGCATGGCAACAGATCTCGAGATCTGTTGCCATGCTTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004760.x-1084s1c1
Sequence:CCGGCAGAGCAGTATTCAAGAGCCTCTCGAGAGGCTCTTGAATACTGCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004760.x-439s1c1
Sequence:CCGGGAGATTGCTGTACTTGAACTACTCGAGTAGTTCAAGTACAGCAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194941    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004760.2-3644s1c1
Sequence:CCGGCTATTGAGTTTACTCGGTTTACTCGAGTAAACCGAGTAAACTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks