EMAIL THIS PAGE TO A FRIEND

STK17B

serine/threonine kinase 17b

Synonyms: DRAK2
UniProtKB ID: O94768
Gene ID:
Mouse(98267) serine/threonine kinase 17b (apoptosis-inducing)
Rat(170904) serine/threonine kinase 17b
Domestic Rabbit(100347229) serine/threonine kinase 17b
naked mole-rat(101713817) serine/threonine kinase 17b
domestic guinea pig(100716043) serine/threonine kinase 17b
cow(511373) serine/threonine kinase 17b
sheep(101119535) serine/threonine kinase 17b
Zebrafish(393507) serine/threonine kinase 17b (apoptosis-inducing)
chicken(424049) serine/threonine kinase 17b
dog(488453) serine/threonine kinase 17b
Horse(100054971) serine/threonine kinase 17b
domestic cat(101086995) serine/threonine kinase 17b
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004226 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004226 Rosetta Predictions human pricing
NM_133392 Rosetta Predictions rat pricing
NM_133810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221922 predicted 1113
2 SASI_Hs01_00221923 predicted 271
3 SASI_Hs01_00221924 predicted 398
4 SASI_Hs01_00221925 predicted 1234
5 SASI_Hs01_00221926 predicted 1000
6 SASI_Hs01_00221927 predicted 706
7 SASI_Hs01_00221928 predicted 620
8 SASI_Hs01_00221929 predicted 941
9 SASI_Hs02_00337143 predicted 295
10 SASI_Hs01_00221930 predicted 987
11 SASI_Hs01_00221931 predicted 1291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043227 predicted 1259
2 SASI_Rn02_00267648 predicted 270
3 SASI_Rn01_00043228 predicted 611
4 SASI_Rn01_00043230 predicted 825
5 SASI_Rn01_00043231 predicted 462
6 SASI_Rn01_00043232 predicted 298
7 SASI_Rn01_00043233 predicted 390
8 SASI_Rn01_00043235 predicted 1300
9 SASI_Rn01_00043236 predicted 533
10 SASI_Rn02_00267649 predicted 840
11 SASI_Rn01_00043229 predicted 543
12 SASI_Rn01_00043234 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092120 predicted 267
2 SASI_Mm01_00092121 predicted 603
3 SASI_Mm01_00092122 predicted 809
4 SASI_Mm01_00092123 predicted 587
5 SASI_Mm01_00092124 predicted 1301
6 SASI_Mm02_00338839 predicted 785
7 SASI_Mm01_00092125 predicted 799
8 SASI_Mm01_00092127 predicted 880
9 SASI_Mm01_00092128 predicted 807
10 SASI_Mm01_00092129 predicted 496
11 SASI_Mm01_00092126 predicted 1166
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004226
VALIDATED
STK17B MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 17b
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196693    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004226.2-1523s1c1
Sequence:CCGGGTTAAATTACTAGTTGCTAGCCTCGAGGCTAGCAACTAGTAATTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004226.2-1392s1c1
Sequence:CCGGCTTTGACTCATTTGGACTGAACTCGAGTTCAGTCCAAATGAGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.2-313s1c1
Sequence:CCGGCAACTCCTCAAATTCCAATAACTCGAGTTATTGGAATTTGAGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004226.2-1494s1c1
Sequence:CCGGCATGGAATAATTTAGGGAAGTCTCGAGACTTCCCTAAATTATTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.2-936s1c1
Sequence:CCGGGCATATATGTTGTTAACTCACCTCGAGGTGAGTTAACAACATATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004226.2-995s1c1
Sequence:CCGGCCTCAATATCTCTCAAGTTAACTCGAGTTAACTTGAGAGATATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.2-1118s1c1
Sequence:CCGGGATATGCCTTTCTCATTCTTGCTCGAGCAAGAATGAGAAAGGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-627s1c1
Sequence:CCGGTGTTTACCTGAGTTGGCTGAACTCGAGTTCAGCCAACTCAGGTAAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-301s1c1
Sequence:CCGGCTACTAACTACAACTCCTCAACTCGAGTTGAGGAGTTGTAGTTAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-628s1c1
Sequence:CCGGTTACCTGAGTTGGCTGAAATGCTCGAGCATTTCAGCCAACTCAGGTAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-1267s1c1
Sequence:CCGGGATAGAGAAGACAAAGAGAATCTCGAGATTCTCTTTGTCTTCTCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-1057s1c1
Sequence:CCGGGCCACAGACTTTATTCAGAGCCTCGAGGCTCTGAATAAAGTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004226.x-760s1c1
Sequence:CCGGAGCAGCATATACCCTCTCGGGCTCGAGCCCGAGAGGGTATATGCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-1236s1c1
Sequence:CCGGACTTCTAAATCCTCCTGTAATCTCGAGATTACAGGAGGATTTAGAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-1269s1c1
Sequence:CCGGGATAGAGAAGACAAAGAGAATCTCGAGATTCTCTTTGTCTTCTCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-1433s1c1
Sequence:CCGGCCAGTGAGATTATGATTTGTACTCGAGTACAAATCATAATCTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004226.3-1846s21c1
Sequence:CCGGACCATGCCTCTATCAACATAACTCGAGTTATGTTGATAGAGGCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004226
VALIDATED
STK17B MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 17b
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196693    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004226.2-1523s1c1
Sequence:CCGGGTTAAATTACTAGTTGCTAGCCTCGAGGCTAGCAACTAGTAATTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004226.2-1392s1c1
Sequence:CCGGCTTTGACTCATTTGGACTGAACTCGAGTTCAGTCCAAATGAGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.2-313s1c1
Sequence:CCGGCAACTCCTCAAATTCCAATAACTCGAGTTATTGGAATTTGAGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004226.2-1494s1c1
Sequence:CCGGCATGGAATAATTTAGGGAAGTCTCGAGACTTCCCTAAATTATTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.2-936s1c1
Sequence:CCGGGCATATATGTTGTTAACTCACCTCGAGGTGAGTTAACAACATATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004226.2-995s1c1
Sequence:CCGGCCTCAATATCTCTCAAGTTAACTCGAGTTAACTTGAGAGATATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.2-1118s1c1
Sequence:CCGGGATATGCCTTTCTCATTCTTGCTCGAGCAAGAATGAGAAAGGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-627s1c1
Sequence:CCGGTGTTTACCTGAGTTGGCTGAACTCGAGTTCAGCCAACTCAGGTAAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-301s1c1
Sequence:CCGGCTACTAACTACAACTCCTCAACTCGAGTTGAGGAGTTGTAGTTAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-628s1c1
Sequence:CCGGTTACCTGAGTTGGCTGAAATGCTCGAGCATTTCAGCCAACTCAGGTAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-1267s1c1
Sequence:CCGGGATAGAGAAGACAAAGAGAATCTCGAGATTCTCTTTGTCTTCTCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-1057s1c1
Sequence:CCGGGCCACAGACTTTATTCAGAGCCTCGAGGCTCTGAATAAAGTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004226.x-760s1c1
Sequence:CCGGAGCAGCATATACCCTCTCGGGCTCGAGCCCGAGAGGGTATATGCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-1236s1c1
Sequence:CCGGACTTCTAAATCCTCCTGTAATCTCGAGATTACAGGAGGATTTAGAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-1269s1c1
Sequence:CCGGGATAGAGAAGACAAAGAGAATCTCGAGATTCTCTTTGTCTTCTCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-1433s1c1
Sequence:CCGGCCAGTGAGATTATGATTTGTACTCGAGTACAAATCATAATCTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004226.3-1846s21c1
Sequence:CCGGACCATGCCTCTATCAACATAACTCGAGTTATGTTGATAGAGGCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004226
VALIDATED
STK17B MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 17b
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196693    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004226.2-1523s1c1
Sequence:CCGGGTTAAATTACTAGTTGCTAGCCTCGAGGCTAGCAACTAGTAATTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004226.2-1392s1c1
Sequence:CCGGCTTTGACTCATTTGGACTGAACTCGAGTTCAGTCCAAATGAGTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.2-313s1c1
Sequence:CCGGCAACTCCTCAAATTCCAATAACTCGAGTTATTGGAATTTGAGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004226.2-1494s1c1
Sequence:CCGGCATGGAATAATTTAGGGAAGTCTCGAGACTTCCCTAAATTATTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.2-936s1c1
Sequence:CCGGGCATATATGTTGTTAACTCACCTCGAGGTGAGTTAACAACATATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004226.2-995s1c1
Sequence:CCGGCCTCAATATCTCTCAAGTTAACTCGAGTTAACTTGAGAGATATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.2-1118s1c1
Sequence:CCGGGATATGCCTTTCTCATTCTTGCTCGAGCAAGAATGAGAAAGGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-627s1c1
Sequence:CCGGTGTTTACCTGAGTTGGCTGAACTCGAGTTCAGCCAACTCAGGTAAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-301s1c1
Sequence:CCGGCTACTAACTACAACTCCTCAACTCGAGTTGAGGAGTTGTAGTTAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-628s1c1
Sequence:CCGGTTACCTGAGTTGGCTGAAATGCTCGAGCATTTCAGCCAACTCAGGTAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-1267s1c1
Sequence:CCGGGATAGAGAAGACAAAGAGAATCTCGAGATTCTCTTTGTCTTCTCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-1057s1c1
Sequence:CCGGGCCACAGACTTTATTCAGAGCCTCGAGGCTCTGAATAAAGTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004226.x-760s1c1
Sequence:CCGGAGCAGCATATACCCTCTCGGGCTCGAGCCCGAGAGGGTATATGCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-1236s1c1
Sequence:CCGGACTTCTAAATCCTCCTGTAATCTCGAGATTACAGGAGGATTTAGAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-1269s1c1
Sequence:CCGGGATAGAGAAGACAAAGAGAATCTCGAGATTCTCTTTGTCTTCTCTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004226.x-1433s1c1
Sequence:CCGGCCAGTGAGATTATGATTTGTACTCGAGTACAAATCATAATCTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004226.3-1846s21c1
Sequence:CCGGACCATGCCTCTATCAACATAACTCGAGTTATGTTGATAGAGGCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133810
STK17B MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 17b
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133810.2-1224s1c1
Sequence:CCGGCCCATGAACTTGTTCCAGATTCTCGAGAATCTGGAACAAGTTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133810.2-1035s1c1
Sequence:CCGGGCTTGTTTCATCCTGAGGAAACTCGAGTTTCCTCAGGATGAAACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133810.2-269s1c1
Sequence:CCGGGCTGTGGTTAGACAATGTATACTCGAGTATACATTGTCTAACCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133810.2-587s1c1
Sequence:CCGGCAGAATAACATTGTTCACCTTCTCGAGAAGGTGAACAATGTTATTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133810.2-753s1c1
Sequence:CCGGTCCTCAACTATGATCCCATTACTCGAGTAATGGGATCATAGTTGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133810
STK17B MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 17b
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133810.2-1224s1c1
Sequence:CCGGCCCATGAACTTGTTCCAGATTCTCGAGAATCTGGAACAAGTTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133810.2-1035s1c1
Sequence:CCGGGCTTGTTTCATCCTGAGGAAACTCGAGTTTCCTCAGGATGAAACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133810.2-269s1c1
Sequence:CCGGGCTGTGGTTAGACAATGTATACTCGAGTATACATTGTCTAACCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133810.2-587s1c1
Sequence:CCGGCAGAATAACATTGTTCACCTTCTCGAGAAGGTGAACAATGTTATTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133810.2-753s1c1
Sequence:CCGGTCCTCAACTATGATCCCATTACTCGAGTAATGGGATCATAGTTGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133810
STK17B MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 17b
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133810.2-1224s1c1
Sequence:CCGGCCCATGAACTTGTTCCAGATTCTCGAGAATCTGGAACAAGTTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133810.2-1035s1c1
Sequence:CCGGGCTTGTTTCATCCTGAGGAAACTCGAGTTTCCTCAGGATGAAACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133810.2-269s1c1
Sequence:CCGGGCTGTGGTTAGACAATGTATACTCGAGTATACATTGTCTAACCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133810.2-587s1c1
Sequence:CCGGCAGAATAACATTGTTCACCTTCTCGAGAAGGTGAACAATGTTATTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133810.2-753s1c1
Sequence:CCGGTCCTCAACTATGATCCCATTACTCGAGTAATGGGATCATAGTTGAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks