EMAIL THIS PAGE TO A FRIEND

STK19

serine/threonine kinase 19

Synonyms: D6S60 D6S60E G11 HLA-RP1 RP1
Gene ID:
Human(8859) Summary: This gene encodes a serine/threonine kinase which localizes predominantly to the nucleus. Its specific function is unknown; it is possible that phosphorylation of this protein is involved in transcriptional regulation. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6 and expresses two transcript variants. [provided by RefSeq, Jul 2008]
Mouse(54402) serine/threonine kinase 19
Rat(361800) serine/threonine kinase 19
Zebrafish(57929) serine/threonine kinase 19
domestic cat(101101310) serine/threonine kinase 19
dog(607545) serine/threonine kinase 19
cow(508320) serine/threonine kinase 19
sheep(101102098) serine/threonine kinase 19
domestic guinea pig(100714503) serine/threonine kinase 19
naked mole-rat(101720976) serine/threonine kinase 19
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019442 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019442 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019442 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004197 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU194591 MISSION® esiRNA esiRNA targeting mouse Stk19 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004197 Rosetta Predictions human pricing
NM_032454 Rosetta Predictions human pricing
NM_001013197 Rosetta Predictions rat pricing
NM_019442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096454 predicted 1162
2 SASI_Hs01_00096456 predicted 997
3 SASI_Hs01_00096457 predicted 1370
4 SASI_Hs01_00096458 predicted 1126
5 SASI_Hs01_00096459 predicted 1067
6 SASI_Hs01_00096460 predicted 1334
7 SASI_Hs01_00096461 predicted 476
8 SASI_Hs01_00096462 predicted 997
9 SASI_Hs01_00096463 predicted 362
10 SASI_Hs02_00337094 predicted 489
11 SASI_Hs01_00096455 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109382 predicted 1170
2 SASI_Hs01_00109384 predicted 1008
3 SASI_Hs01_00109385 predicted 1390
4 SASI_Hs01_00109386 predicted 1143
5 SASI_Hs01_00109387 predicted 1075
6 SASI_Hs01_00109388 predicted 1342
7 SASI_Hs01_00109389 predicted 472
8 SASI_Hs01_00109390 predicted 1007
9 SASI_Hs01_00109391 predicted 359
10 SASI_Hs02_00359890 predicted 490
11 SASI_Hs01_00109383 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093469 predicted 313
2 SASI_Rn01_00093470 predicted 347
3 SASI_Rn01_00093471 predicted 590
4 SASI_Rn01_00093473 predicted 700
5 SASI_Rn02_00200960 predicted 590
6 SASI_Rn01_00093474 predicted 332
7 SASI_Rn01_00093476 predicted 912
8 SASI_Rn01_00093477 predicted 227
9 SASI_Rn01_00093478 predicted 747
10 SASI_Rn02_00200961 predicted 226
11 SASI_Rn01_00093472 predicted 715
12 SASI_Rn01_00093475 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091792 predicted 283
2 SASI_Mm01_00091795 predicted 326
3 SASI_Mm01_00091796 predicted 298
4 SASI_Mm02_00324412 predicted 472
5 SASI_Mm01_00091798 predicted 488
6 SASI_Mm02_00324413 predicted 608
7 SASI_Mm02_00324414 predicted 203
8 SASI_Mm02_00324415 predicted 483
9 SASI_Mm02_00324416 predicted 439
10 SASI_Mm01_00091793 predicted 689
11 SASI_Mm01_00091791 predicted 281
12 SASI_Mm01_00091794 predicted 574
13 SASI_Mm01_00091797 predicted 793
14 SASI_Mm01_00091799 predicted 797
15 SASI_Mm01_00091800 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019442
VALIDATED
STK19 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 19
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019442.3-330s21c1
Sequence:CCGGGATTGTCTTCACGGAAGACTACTCGAGTAGTCTTCCGTGAAGACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019442.3-574s21c1
Sequence:CCGGAGATTCATCAAGTGCTTTGTTCTCGAGAACAAAGCACTTGATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019442.3-98s21c1
Sequence:CCGGTGAGAGCGGATCCTTTAAGAACTCGAGTTCTTAAAGGATCCGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019442.3-292s21c1
Sequence:CCGGCGAATTATCCAGCTAGGCTTTCTCGAGAAAGCCTAGCTGGATAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019442.3-462s21c1
Sequence:CCGGGATGACACAGACTTATGGCTTCTCGAGAAGCCATAAGTCTGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019442.2-292s1c1
Sequence:CCGGCGAATTATCCAGCTAGGCTTTCTCGAGAAAGCCTAGCTGGATAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019442.2-98s1c1
Sequence:CCGGTGAGAGCGGATCCTTTAAGAACTCGAGTTCTTAAAGGATCCGCTCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019442.2-462s1c1
Sequence:CCGGGATGACACAGACTTATGGCTTCTCGAGAAGCCATAAGTCTGTGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019442.2-574s1c1
Sequence:CCGGAGATTCATCAAGTGCTTTGTTCTCGAGAACAAAGCACTTGATGAATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019442.2-330s1c1
Sequence:CCGGGATTGTCTTCACGGAAGACTACTCGAGTAGTCTTCCGTGAAGACAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019442
VALIDATED
STK19 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 19
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019442.3-330s21c1
Sequence:CCGGGATTGTCTTCACGGAAGACTACTCGAGTAGTCTTCCGTGAAGACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019442.3-574s21c1
Sequence:CCGGAGATTCATCAAGTGCTTTGTTCTCGAGAACAAAGCACTTGATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019442.3-98s21c1
Sequence:CCGGTGAGAGCGGATCCTTTAAGAACTCGAGTTCTTAAAGGATCCGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019442.3-292s21c1
Sequence:CCGGCGAATTATCCAGCTAGGCTTTCTCGAGAAAGCCTAGCTGGATAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019442.3-462s21c1
Sequence:CCGGGATGACACAGACTTATGGCTTCTCGAGAAGCCATAAGTCTGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019442.2-292s1c1
Sequence:CCGGCGAATTATCCAGCTAGGCTTTCTCGAGAAAGCCTAGCTGGATAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019442.2-98s1c1
Sequence:CCGGTGAGAGCGGATCCTTTAAGAACTCGAGTTCTTAAAGGATCCGCTCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019442.2-462s1c1
Sequence:CCGGGATGACACAGACTTATGGCTTCTCGAGAAGCCATAAGTCTGTGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019442.2-574s1c1
Sequence:CCGGAGATTCATCAAGTGCTTTGTTCTCGAGAACAAAGCACTTGATGAATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019442.2-330s1c1
Sequence:CCGGGATTGTCTTCACGGAAGACTACTCGAGTAGTCTTCCGTGAAGACAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019442
VALIDATED
STK19 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 19
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019442.3-330s21c1
Sequence:CCGGGATTGTCTTCACGGAAGACTACTCGAGTAGTCTTCCGTGAAGACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019442.3-574s21c1
Sequence:CCGGAGATTCATCAAGTGCTTTGTTCTCGAGAACAAAGCACTTGATGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019442.3-98s21c1
Sequence:CCGGTGAGAGCGGATCCTTTAAGAACTCGAGTTCTTAAAGGATCCGCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019442.3-292s21c1
Sequence:CCGGCGAATTATCCAGCTAGGCTTTCTCGAGAAAGCCTAGCTGGATAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019442.3-462s21c1
Sequence:CCGGGATGACACAGACTTATGGCTTCTCGAGAAGCCATAAGTCTGTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019442.2-292s1c1
Sequence:CCGGCGAATTATCCAGCTAGGCTTTCTCGAGAAAGCCTAGCTGGATAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019442.2-98s1c1
Sequence:CCGGTGAGAGCGGATCCTTTAAGAACTCGAGTTCTTAAAGGATCCGCTCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019442.2-462s1c1
Sequence:CCGGGATGACACAGACTTATGGCTTCTCGAGAAGCCATAAGTCTGTGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019442.2-574s1c1
Sequence:CCGGAGATTCATCAAGTGCTTTGTTCTCGAGAACAAAGCACTTGATGAATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019442.2-330s1c1
Sequence:CCGGGATTGTCTTCACGGAAGACTACTCGAGTAGTCTTCCGTGAAGACAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004197
VALIDATED
STK19 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 19
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004197.1-1003s21c1
Sequence:GTACCGGGGAGATTCATCAAGTACTTTGCTCGAGCAAAGTACTTGATGAATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004197.1-1438s21c1
Sequence:CCGGATGGAAAGTGGAACCAGAAATCTCGAGATTTCTGGTTCCACTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004197.1-1221s21c1
Sequence:CCGGTGAAGATTCTGCTCATCATTGCTCGAGCAATGATGAGCAGAATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004197.1-747s21c1
Sequence:CCGGTTGGATGCCCATGGAATTATCCTCGAGGATAATTCCATGGGCATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004197.1-486s21c1
Sequence:CCGGCCGGAGACCTTTGGAGTTAAGCTCGAGCTTAACTCCAAAGGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004197.x-804s1c1
Sequence:CCGGTGTGATGGCCGACCGTATGCTCTCGAGAGCATACGGTCGGCCATCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004197.x-1177s1c1
Sequence:CCGGGCATCTCTACCACTTCAGGAACTCGAGTTCCTGAAGTGGTAGAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004197.x-992s1c1
Sequence:CCGGGCCTGGAGCTGGGAGATTCATCTCGAGATGAATCTCCCAGCTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004197.x-887s1c1
Sequence:CCGGGGACCAAATGACACAGACCTTCTCGAGAAGGTCTGTGTCATTTGGTCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004197.x-485s1c1
Sequence:CCGGCCCGGAGACCTTTGGAGTTAACTCGAGTTAACTCCAAAGGTCTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004197.1-1468s1c1
Sequence:CCGGGCTGTGGCTGTTCCCTTTCGTCTCGAGACGAAAGGGAACAGCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004197.x-1500s1c1
Sequence:CCGGCTGTTATTACTCTGTCTTGAACTCGAGTTCAAGACAGAGTAATAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004197.1-1436s1c1
Sequence:CCGGCCATGGAAAGTGGAACCAGAACTCGAGTTCTGGTTCCACTTTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004197.1-1270s1c1
Sequence:CCGGGACTAGAAGAGCTGCATGATGCTCGAGCATCATGCAGCTCTTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004197.1-1328s1c1
Sequence:CCGGCCAGGATGAGTGTCGGGCTCTCTCGAGAGAGCCCGACACTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004197
VALIDATED
STK19 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 19
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004197.1-1003s21c1
Sequence:GTACCGGGGAGATTCATCAAGTACTTTGCTCGAGCAAAGTACTTGATGAATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004197.1-1438s21c1
Sequence:CCGGATGGAAAGTGGAACCAGAAATCTCGAGATTTCTGGTTCCACTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004197.1-1221s21c1
Sequence:CCGGTGAAGATTCTGCTCATCATTGCTCGAGCAATGATGAGCAGAATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004197.1-747s21c1
Sequence:CCGGTTGGATGCCCATGGAATTATCCTCGAGGATAATTCCATGGGCATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004197.1-486s21c1
Sequence:CCGGCCGGAGACCTTTGGAGTTAAGCTCGAGCTTAACTCCAAAGGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004197.x-804s1c1
Sequence:CCGGTGTGATGGCCGACCGTATGCTCTCGAGAGCATACGGTCGGCCATCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004197.x-1177s1c1
Sequence:CCGGGCATCTCTACCACTTCAGGAACTCGAGTTCCTGAAGTGGTAGAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004197.x-992s1c1
Sequence:CCGGGCCTGGAGCTGGGAGATTCATCTCGAGATGAATCTCCCAGCTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004197.x-887s1c1
Sequence:CCGGGGACCAAATGACACAGACCTTCTCGAGAAGGTCTGTGTCATTTGGTCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004197.x-485s1c1
Sequence:CCGGCCCGGAGACCTTTGGAGTTAACTCGAGTTAACTCCAAAGGTCTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004197.1-1468s1c1
Sequence:CCGGGCTGTGGCTGTTCCCTTTCGTCTCGAGACGAAAGGGAACAGCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004197.x-1500s1c1
Sequence:CCGGCTGTTATTACTCTGTCTTGAACTCGAGTTCAAGACAGAGTAATAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004197.1-1436s1c1
Sequence:CCGGCCATGGAAAGTGGAACCAGAACTCGAGTTCTGGTTCCACTTTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004197.1-1270s1c1
Sequence:CCGGGACTAGAAGAGCTGCATGATGCTCGAGCATCATGCAGCTCTTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004197.1-1328s1c1
Sequence:CCGGCCAGGATGAGTGTCGGGCTCTCTCGAGAGAGCCCGACACTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004197
VALIDATED
STK19 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 19
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004197.1-1003s21c1
Sequence:GTACCGGGGAGATTCATCAAGTACTTTGCTCGAGCAAAGTACTTGATGAATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004197.1-1438s21c1
Sequence:CCGGATGGAAAGTGGAACCAGAAATCTCGAGATTTCTGGTTCCACTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004197.1-1221s21c1
Sequence:CCGGTGAAGATTCTGCTCATCATTGCTCGAGCAATGATGAGCAGAATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_004197.1-747s21c1
Sequence:CCGGTTGGATGCCCATGGAATTATCCTCGAGGATAATTCCATGGGCATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004197.1-486s21c1
Sequence:CCGGCCGGAGACCTTTGGAGTTAAGCTCGAGCTTAACTCCAAAGGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004197.x-804s1c1
Sequence:CCGGTGTGATGGCCGACCGTATGCTCTCGAGAGCATACGGTCGGCCATCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004197.x-1177s1c1
Sequence:CCGGGCATCTCTACCACTTCAGGAACTCGAGTTCCTGAAGTGGTAGAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004197.x-992s1c1
Sequence:CCGGGCCTGGAGCTGGGAGATTCATCTCGAGATGAATCTCCCAGCTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004197.x-887s1c1
Sequence:CCGGGGACCAAATGACACAGACCTTCTCGAGAAGGTCTGTGTCATTTGGTCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004197.x-485s1c1
Sequence:CCGGCCCGGAGACCTTTGGAGTTAACTCGAGTTAACTCCAAAGGTCTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004197.1-1468s1c1
Sequence:CCGGGCTGTGGCTGTTCCCTTTCGTCTCGAGACGAAAGGGAACAGCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004197.x-1500s1c1
Sequence:CCGGCTGTTATTACTCTGTCTTGAACTCGAGTTCAAGACAGAGTAATAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004197.1-1436s1c1
Sequence:CCGGCCATGGAAAGTGGAACCAGAACTCGAGTTCTGGTTCCACTTTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004197.1-1270s1c1
Sequence:CCGGGACTAGAAGAGCTGCATGATGCTCGAGCATCATGCAGCTCTTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004197.1-1328s1c1
Sequence:CCGGCCAGGATGAGTGTCGGGCTCTCTCGAGAGAGCCCGACACTCATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks