EMAIL THIS PAGE TO A FRIEND

STK24

serine/threonine kinase 24

Synonyms: MST3 MST3B STE20 STK3
UniProtKB ID: Q9Y6E0, O14840, Q5JV92
Gene ID:
Human(8428) Summary: The yeast 'Sterile 20' gene (STE20) functions upstream of the mitogen-activated protein kinase (MAPK) cascade. In mammals, protein kinases related to STE20 can be divided into 2 subfamilies based on their structure and regulation. Members of the PAK subfamily (see PAK3; MIM 300142) contain a C-terminal catalytic domain and an N-terminal regulatory domain that has a CDC42 (MIM 116952)-binding domain. In contrast, members of the GCK subfamily (see MAP4K2; MIM 603166), also called the Sps1 subfamily, have an N-terminal catalytic domain and a C-terminal regulatory domain without a CDC42-binding domain. STK24 belongs to the GCK subfamily of STE20-like kinases (Zhou et al., 2000 [PubMed 10644707]
Mouse(223255) serine/threonine kinase 24
Rat(361092) serine/threonine kinase 24
chicken(418780) serine/threonine kinase 24
dog(100688038) serine/threonine kinase 24
domestic cat(101098426) serine/threonine kinase 24
cow(100101492) serine/threonine kinase 24
sheep(101111464) serine/threonine kinase 24
domestic guinea pig(100725244) serine/threonine kinase 24
naked mole-rat(101717475) serine/threonine kinase 24
Domestic Rabbit(100353169) serine/threonine kinase 24
200 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302077 ANTI-MOUSE STK24 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB1300430 Anti-MST3 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1305413 ANTI-MST3(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA026435 Anti-STK24 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 mouse, human, rat
immunohistochemistry, western blot pricing
HPA026502 Anti-STK24 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503342 Anti-STK24, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB1404580 Monoclonal Anti-STK24 antibody produced in mouse clone 4G5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1402420 Monoclonal Anti-STK24 antibody produced in mouse clone 1E12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003576 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032296 siRNAs that have been validated in the lab human pricing
NM_003576 siRNAs that have been validated in the lab human pricing
NM_001127494 Rosetta Predictions rat pricing
NM_145465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032296 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146086 validated 1146
2 SASI_Hs01_00146090 predicted 1129
3 SASI_Hs02_00307885 predicted 601
4 SASI_Hs02_00307886 predicted 1147
5 SASI_Hs02_00307887 predicted 1361
6 SASI_Hs01_00146093 predicted 1194
7 SASI_Hs02_00307888 predicted 1168
8 SASI_Hs02_00307889 predicted 1320
9 SASI_Hs02_00307890 predicted 595
10 SASI_Hs02_00307891 predicted 612
11 SASI_Hs01_00146087 predicted 925
12 SASI_Hs01_00146088 predicted 667
13 SASI_Hs01_00146089 predicted 569
14 SASI_Hs01_00146091 predicted 670
15 SASI_Hs01_00146092 predicted 655
16 SASI_Hs01_00146094 predicted 749
17 SASI_Hs01_00146095 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003576 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095388 validated 1057
2 SASI_Hs01_00095392 predicted 1045
3 SASI_Hs02_00335884 predicted 512
4 SASI_Hs02_00335885 predicted 1067
5 SASI_Hs02_00335886 predicted 1276
6 SASI_Hs01_00095395 predicted 1108
7 SASI_Hs02_00335887 predicted 1081
8 SASI_Hs02_00335888 predicted 1241
9 SASI_Hs02_00335889 predicted 514
10 SASI_Hs02_00335890 predicted 525
11 SASI_Hs01_00095389 predicted 797
12 SASI_Hs01_00095390 predicted 533
13 SASI_Hs01_00095391 predicted 436
14 SASI_Hs01_00095393 predicted 541
15 SASI_Hs01_00095394 predicted 526
16 SASI_Hs01_00095396 predicted 629
17 SASI_Hs01_00095397 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253903 predicted 263
2 SASI_Rn02_00253904 predicted 788
3 SASI_Rn02_00253905 predicted 381
4 SASI_Rn02_00253906 predicted 328
5 SASI_Rn02_00253907 predicted 376
6 SASI_Rn02_00253908 predicted 1041
7 SASI_Rn02_00253909 predicted 246
8 SASI_Rn02_00253910 predicted 264
9 SASI_Rn02_00253911 predicted 966
10 SASI_Rn02_00253912 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052449 predicted 1370
2 SASI_Mm01_00052451 predicted 420
3 SASI_Mm02_00340861 predicted 1062
4 SASI_Mm01_00052452 predicted 1142
5 SASI_Mm01_00052453 predicted 488
6 SASI_Mm01_00052454 predicted 538
7 SASI_Mm01_00052455 predicted 1510
8 SASI_Mm01_00052456 predicted 1468
9 SASI_Mm02_00340862 predicted 618
10 SASI_Mm01_00052457 predicted 562
11 SASI_Mm01_00052450 predicted 1195
12 SASI_Mm01_00052458 predicted 985
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003576
VALIDATED
STK24 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 24
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.2-792s1c1
Sequence:CCGGCCCTGGGCATAACAGCTATTGCTCGAGCAATAGCTGTTATGCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.2-1278s1c1
Sequence:CCGGCAATTATTTCTCCTCTGTTTGCTCGAGCAAACAGAGGAGAAATAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.2-968s1c1
Sequence:CCGGCCCACTGCTAAGGAGTTATTGCTCGAGCAATAACTCCTTAGCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003576.2-2021s1c1
Sequence:CCGGGCCATAAACTTGAGTCTATTGCTCGAGCAATAGACTCAAGTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003576.2-429s1c1
Sequence:CCGGCCAAATATTATGGATCCTATCCTCGAGGATAGGATCCATAATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.x-2107s1c1
Sequence:CCGGGCAGGGTTTGTCATTAATAATCTCGAGATTATTAATGACAAACCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003576.x-606s1c1
Sequence:CCGGACAGAGACATTAAAGCGGCCACTCGAGTGGCCGCTTTAATGTCTCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.x-1046s1c1
Sequence:CCGGGACAGGTACAAGAGATGGAAGCTCGAGCTTCCATCTCTTGTACCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.x-1297s1c1
Sequence:CCGGTGCAGAGTTGAAGGAGAAGAGCTCGAGCTCTTCTCCTTCAACTCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.x-1221s1c1
Sequence:CCGGTGGACAGAAATAAGATGAAAGCTCGAGCTTTCATCTTATTTCTGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003576.3-1058s21c1
Sequence:CCGGCCCACTGCTAAGGAGTTATTGCTCGAGCAATAACTCCTTAGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003576.3-1387s21c1
Sequence:CCGGTGCAGAGTTGAAGGAGAAGAGCTCGAGCTCTTCTCCTTCAACTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003576.3-1136s21c1
Sequence:CCGGGACAGGTACAAGAGATGGAAGCTCGAGCTTCCATCTCTTGTACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003576.3-882s21c1
Sequence:CCGGCCCTGGGCATAACAGCTATTGCTCGAGCAATAGCTGTTATGCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003576
VALIDATED
STK24 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 24
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.2-792s1c1
Sequence:CCGGCCCTGGGCATAACAGCTATTGCTCGAGCAATAGCTGTTATGCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.2-1278s1c1
Sequence:CCGGCAATTATTTCTCCTCTGTTTGCTCGAGCAAACAGAGGAGAAATAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.2-968s1c1
Sequence:CCGGCCCACTGCTAAGGAGTTATTGCTCGAGCAATAACTCCTTAGCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003576.2-2021s1c1
Sequence:CCGGGCCATAAACTTGAGTCTATTGCTCGAGCAATAGACTCAAGTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003576.2-429s1c1
Sequence:CCGGCCAAATATTATGGATCCTATCCTCGAGGATAGGATCCATAATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.x-2107s1c1
Sequence:CCGGGCAGGGTTTGTCATTAATAATCTCGAGATTATTAATGACAAACCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003576.x-606s1c1
Sequence:CCGGACAGAGACATTAAAGCGGCCACTCGAGTGGCCGCTTTAATGTCTCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.x-1046s1c1
Sequence:CCGGGACAGGTACAAGAGATGGAAGCTCGAGCTTCCATCTCTTGTACCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.x-1297s1c1
Sequence:CCGGTGCAGAGTTGAAGGAGAAGAGCTCGAGCTCTTCTCCTTCAACTCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.x-1221s1c1
Sequence:CCGGTGGACAGAAATAAGATGAAAGCTCGAGCTTTCATCTTATTTCTGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003576.3-1058s21c1
Sequence:CCGGCCCACTGCTAAGGAGTTATTGCTCGAGCAATAACTCCTTAGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003576.3-1387s21c1
Sequence:CCGGTGCAGAGTTGAAGGAGAAGAGCTCGAGCTCTTCTCCTTCAACTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003576.3-1136s21c1
Sequence:CCGGGACAGGTACAAGAGATGGAAGCTCGAGCTTCCATCTCTTGTACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003576.3-882s21c1
Sequence:CCGGCCCTGGGCATAACAGCTATTGCTCGAGCAATAGCTGTTATGCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003576
VALIDATED
STK24 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 24
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.2-792s1c1
Sequence:CCGGCCCTGGGCATAACAGCTATTGCTCGAGCAATAGCTGTTATGCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.2-1278s1c1
Sequence:CCGGCAATTATTTCTCCTCTGTTTGCTCGAGCAAACAGAGGAGAAATAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.2-968s1c1
Sequence:CCGGCCCACTGCTAAGGAGTTATTGCTCGAGCAATAACTCCTTAGCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003576.2-2021s1c1
Sequence:CCGGGCCATAAACTTGAGTCTATTGCTCGAGCAATAGACTCAAGTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003576.2-429s1c1
Sequence:CCGGCCAAATATTATGGATCCTATCCTCGAGGATAGGATCCATAATATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.x-2107s1c1
Sequence:CCGGGCAGGGTTTGTCATTAATAATCTCGAGATTATTAATGACAAACCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003576.x-606s1c1
Sequence:CCGGACAGAGACATTAAAGCGGCCACTCGAGTGGCCGCTTTAATGTCTCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.x-1046s1c1
Sequence:CCGGGACAGGTACAAGAGATGGAAGCTCGAGCTTCCATCTCTTGTACCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.x-1297s1c1
Sequence:CCGGTGCAGAGTTGAAGGAGAAGAGCTCGAGCTCTTCTCCTTCAACTCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003576.x-1221s1c1
Sequence:CCGGTGGACAGAAATAAGATGAAAGCTCGAGCTTTCATCTTATTTCTGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003576.3-1058s21c1
Sequence:CCGGCCCACTGCTAAGGAGTTATTGCTCGAGCAATAACTCCTTAGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003576.3-1387s21c1
Sequence:CCGGTGCAGAGTTGAAGGAGAAGAGCTCGAGCTCTTCTCCTTCAACTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003576.3-1136s21c1
Sequence:CCGGGACAGGTACAAGAGATGGAAGCTCGAGCTTCCATCTCTTGTACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003576.3-882s21c1
Sequence:CCGGCCCTGGGCATAACAGCTATTGCTCGAGCAATAGCTGTTATGCCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145465
VALIDATED
STK24 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 24
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145465.1-487s1c1
Sequence:CCGGGCAACCATATTACGAGAAATTCTCGAGAATTTCTCGTAATATGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145465.1-459s1c1
Sequence:CCGGGCCTGGCCCTTTAGATGAAATCTCGAGATTTCATCTAAAGGGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145465.1-978s1c1
Sequence:CCGGCGAGCTTATCGACAGGTACAACTCGAGTTGTACCTGTCGATAAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145465.1-197s1c1
Sequence:CCGGCCAAGCTAGAGAAGATTGGAACTCGAGTTCCAATCTTCTCTAGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145465.1-1203s1c1
Sequence:CCGGCTCTCAGTGTTTATCCACAATCTCGAGATTGTGGATAAACACTGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145465.2-1371s21c1
Sequence:CCGGCTCTCAGTGTTTATCCACAATCTCGAGATTGTGGATAAACACTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145465.2-530s21c1
Sequence:CCGGCCTACGTCACCAAGTACTATGCTCGAGCATAGTACTTGGTGACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145465.2-901s21c1
Sequence:CCGGTCCCTTGGCATCACCGCAATACTCGAGTATTGCGGTGATGCCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145465.2-553s21c1
Sequence:CCGGTCCTATCTCAAGGATACTAAGCTCGAGCTTAGTATCCTTGAGATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145465.2-627s21c1
Sequence:CCGGGCCTGGCCCTTTAGATGAAATCTCGAGATTTCATCTAAAGGGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145465
VALIDATED
STK24 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 24
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145465.1-487s1c1
Sequence:CCGGGCAACCATATTACGAGAAATTCTCGAGAATTTCTCGTAATATGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145465.1-459s1c1
Sequence:CCGGGCCTGGCCCTTTAGATGAAATCTCGAGATTTCATCTAAAGGGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145465.1-978s1c1
Sequence:CCGGCGAGCTTATCGACAGGTACAACTCGAGTTGTACCTGTCGATAAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145465.1-197s1c1
Sequence:CCGGCCAAGCTAGAGAAGATTGGAACTCGAGTTCCAATCTTCTCTAGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145465.1-1203s1c1
Sequence:CCGGCTCTCAGTGTTTATCCACAATCTCGAGATTGTGGATAAACACTGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145465.2-1371s21c1
Sequence:CCGGCTCTCAGTGTTTATCCACAATCTCGAGATTGTGGATAAACACTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145465.2-530s21c1
Sequence:CCGGCCTACGTCACCAAGTACTATGCTCGAGCATAGTACTTGGTGACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145465.2-901s21c1
Sequence:CCGGTCCCTTGGCATCACCGCAATACTCGAGTATTGCGGTGATGCCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145465.2-553s21c1
Sequence:CCGGTCCTATCTCAAGGATACTAAGCTCGAGCTTAGTATCCTTGAGATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145465.2-627s21c1
Sequence:CCGGGCCTGGCCCTTTAGATGAAATCTCGAGATTTCATCTAAAGGGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145465
VALIDATED
STK24 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 24
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145465.1-487s1c1
Sequence:CCGGGCAACCATATTACGAGAAATTCTCGAGAATTTCTCGTAATATGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145465.1-459s1c1
Sequence:CCGGGCCTGGCCCTTTAGATGAAATCTCGAGATTTCATCTAAAGGGCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145465.1-978s1c1
Sequence:CCGGCGAGCTTATCGACAGGTACAACTCGAGTTGTACCTGTCGATAAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145465.1-197s1c1
Sequence:CCGGCCAAGCTAGAGAAGATTGGAACTCGAGTTCCAATCTTCTCTAGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145465.1-1203s1c1
Sequence:CCGGCTCTCAGTGTTTATCCACAATCTCGAGATTGTGGATAAACACTGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145465.2-1371s21c1
Sequence:CCGGCTCTCAGTGTTTATCCACAATCTCGAGATTGTGGATAAACACTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145465.2-530s21c1
Sequence:CCGGCCTACGTCACCAAGTACTATGCTCGAGCATAGTACTTGGTGACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145465.2-901s21c1
Sequence:CCGGTCCCTTGGCATCACCGCAATACTCGAGTATTGCGGTGATGCCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145465.2-553s21c1
Sequence:CCGGTCCTATCTCAAGGATACTAAGCTCGAGCTTAGTATCCTTGAGATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145465.2-627s21c1
Sequence:CCGGGCCTGGCCCTTTAGATGAAATCTCGAGATTTCATCTAAAGGGCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks