EMAIL THIS PAGE TO A FRIEND

STK25

serine/threonine kinase 25

Synonyms: SOK1 YSK1
UniProtKB ID: O00506, A8K7D2, Q15522, Q5BJF1
Gene ID:
Human(10494) Summary: This gene encodes a member of the germinal centre kinase III (GCK III) subfamily of the sterile 20 superfamily of kinases. The encoded enzyme plays a role in serine-threonine liver kinase B1 (LKB1) signaling pathway to regulate neuronal polarization and morphology of the Golgi apparatus. The protein is translocated from the Golgi apparatus to the nucleus in response to chemical anoxia and plays a role in regulation of cell death. A pseudogene associated with this gene is located on chromosome 18. Multiple alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]
Mouse(59041) serine/threonine kinase 25 (yeast)
Rat(373542) serine/threonine kinase 25
chicken(378801) serine/threonine kinase 25
dog(403531) serine/threonine kinase 25
domestic cat(101091135) serine/threonine kinase 25
naked mole-rat(101717757) serine/threonine kinase 25
domestic guinea pig(100723943) serine/threonine kinase 25
cow(373543) serine/threonine kinase 25
sheep(101123003) serine/threonine kinase 25
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006374 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006374 Rosetta Predictions human pricing
NM_184049 Rosetta Predictions rat pricing
NM_021537 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075971 predicted 980
2 SASI_Hs01_00075972 predicted 349
3 SASI_Hs01_00075973 predicted 281
4 SASI_Hs01_00075974 predicted 1531
5 SASI_Hs01_00075975 predicted 472
6 SASI_Hs01_00075976 predicted 315
7 SASI_Hs02_00341433 predicted 1304
8 SASI_Hs01_00075977 predicted 1303
9 SASI_Hs01_00075978 predicted 646
10 SASI_Hs02_00341434 predicted 499
11 SASI_Hs01_00075969 predicted 1492
12 SASI_Hs01_00075970 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184049 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077636 predicted 1445
2 SASI_Rn01_00077637 predicted 997
3 SASI_Rn01_00077638 predicted 978
4 SASI_Rn01_00077639 predicted 230
5 SASI_Rn01_00077640 predicted 1440
6 SASI_Rn02_00269904 predicted 538
7 SASI_Rn01_00077641 predicted 297
8 SASI_Rn01_00077642 predicted 224
9 SASI_Rn01_00077643 predicted 495
10 SASI_Rn01_00077644 predicted 1358
11 SASI_Rn01_00077635 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068595 predicted 1074
2 SASI_Mm01_00068596 predicted 635
3 SASI_Mm01_00068597 predicted 449
4 SASI_Mm01_00068598 predicted 575
5 SASI_Mm01_00068599 predicted 1491
6 SASI_Mm01_00068600 predicted 418
7 SASI_Mm01_00068602 predicted 1516
8 SASI_Mm01_00068603 predicted 959
9 SASI_Mm02_00326275 predicted 1431
10 SASI_Mm02_00326276 predicted 1518
11 SASI_Mm01_00068594 predicted 1059
12 SASI_Mm01_00068601 predicted 691
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021537
VALIDATED
STK25 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 25
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021537.3-906s21c1
Sequence:CCGGCCTGTTCCTGATTCCCAAGAACTCGAGTTCTTGGGAATCAGGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021537.3-1035s21c1
Sequence:CCGGGCACAAATTCATCACACGATACTCGAGTATCGTGTGATGAATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021537.3-1962s21c1
Sequence:CCGGCTCGAATCGTCCAGAATATTTCTCGAGAAATATTCTGGACGATTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021537.3-975s21c1
Sequence:CCGGTGTAGAGGCCTGCCTCAATAACTCGAGTTATTGAGGCAGGCCTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021537.3-1079s21c1
Sequence:CCGGCTGAACTTATTGACCGATATACTCGAGTATATCGGTCAATAAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021537.2-1014s1c1
Sequence:CCGGCTGAACTTATTGACCGATATACTCGAGTATATCGGTCAATAAGTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021537.2-514s1c1
Sequence:CCGGGACCTATATTGCCACCATCTTCTCGAGAAGATGGTGGCAATATAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021537.2-970s1c1
Sequence:CCGGGCACAAATTCATCACACGATACTCGAGTATCGTGTGATGAATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021537.2-394s1c1
Sequence:CCGGCAGTCCTTATATCACCCGCTACTCGAGTAGCGGGTGATATAAGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021537.2-841s1c1
Sequence:CCGGCCTGTTCCTGATTCCCAAGAACTCGAGTTCTTGGGAATCAGGAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021537
VALIDATED
STK25 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 25
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021537.3-906s21c1
Sequence:CCGGCCTGTTCCTGATTCCCAAGAACTCGAGTTCTTGGGAATCAGGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021537.3-1035s21c1
Sequence:CCGGGCACAAATTCATCACACGATACTCGAGTATCGTGTGATGAATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021537.3-1962s21c1
Sequence:CCGGCTCGAATCGTCCAGAATATTTCTCGAGAAATATTCTGGACGATTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021537.3-975s21c1
Sequence:CCGGTGTAGAGGCCTGCCTCAATAACTCGAGTTATTGAGGCAGGCCTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021537.3-1079s21c1
Sequence:CCGGCTGAACTTATTGACCGATATACTCGAGTATATCGGTCAATAAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021537.2-1014s1c1
Sequence:CCGGCTGAACTTATTGACCGATATACTCGAGTATATCGGTCAATAAGTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021537.2-514s1c1
Sequence:CCGGGACCTATATTGCCACCATCTTCTCGAGAAGATGGTGGCAATATAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021537.2-970s1c1
Sequence:CCGGGCACAAATTCATCACACGATACTCGAGTATCGTGTGATGAATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021537.2-394s1c1
Sequence:CCGGCAGTCCTTATATCACCCGCTACTCGAGTAGCGGGTGATATAAGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021537.2-841s1c1
Sequence:CCGGCCTGTTCCTGATTCCCAAGAACTCGAGTTCTTGGGAATCAGGAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021537
VALIDATED
STK25 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 25
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021537.3-906s21c1
Sequence:CCGGCCTGTTCCTGATTCCCAAGAACTCGAGTTCTTGGGAATCAGGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021537.3-1035s21c1
Sequence:CCGGGCACAAATTCATCACACGATACTCGAGTATCGTGTGATGAATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021537.3-1962s21c1
Sequence:CCGGCTCGAATCGTCCAGAATATTTCTCGAGAAATATTCTGGACGATTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021537.3-975s21c1
Sequence:CCGGTGTAGAGGCCTGCCTCAATAACTCGAGTTATTGAGGCAGGCCTCTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021537.3-1079s21c1
Sequence:CCGGCTGAACTTATTGACCGATATACTCGAGTATATCGGTCAATAAGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021537.2-1014s1c1
Sequence:CCGGCTGAACTTATTGACCGATATACTCGAGTATATCGGTCAATAAGTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021537.2-514s1c1
Sequence:CCGGGACCTATATTGCCACCATCTTCTCGAGAAGATGGTGGCAATATAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021537.2-970s1c1
Sequence:CCGGGCACAAATTCATCACACGATACTCGAGTATCGTGTGATGAATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021537.2-394s1c1
Sequence:CCGGCAGTCCTTATATCACCCGCTACTCGAGTAGCGGGTGATATAAGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021537.2-841s1c1
Sequence:CCGGCCTGTTCCTGATTCCCAAGAACTCGAGTTCTTGGGAATCAGGAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006374
STK25 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 25
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006374.3-1058s1c1
Sequence:CCGGGGAGCTCATCGACCGCTATAACTCGAGTTATAGCGGTCGATGAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006374.3-442s1c1
Sequence:CCGGCCTACATCACCCGCTACTTTGCTCGAGCAAAGTAGCGGGTGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006374.3-1993s1c1
Sequence:CCGGGCTCATAAGTACTTGTGTCATCTCGAGATGACACAAGTACTTATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006374.3-719s1c1
Sequence:CCGGGCAGATTAAGAGGAACACATTCTCGAGAATGTGTTCCTCTTAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006374.3-597s1c1
Sequence:CCGGCTGGATTATCTGCACTCCGAACTCGAGTTCGGAGTGCAGATAATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006374.3-1004s1c1
Sequence:CCGGGCTCCTGAAGCACAAGTTCATCTCGAGATGAACTTGTGCTTCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199937    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006374.3-1951s1c1
Sequence:CCGGGCCATAGATTTGCCTTGTGGTCTCGAGACCACAAGGCAAATCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006374.3-261s1c1
Sequence:CCGGCCTGAGGAGCTCTTCACCAAGCTCGAGCTTGGTGAAGAGCTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006374.3-567s1c1
Sequence:CCGGGCCACGATCCTGCGGGAGATTCTCGAGAATCTCCCGCAGGATCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006374
STK25 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 25
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006374.3-1058s1c1
Sequence:CCGGGGAGCTCATCGACCGCTATAACTCGAGTTATAGCGGTCGATGAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006374.3-442s1c1
Sequence:CCGGCCTACATCACCCGCTACTTTGCTCGAGCAAAGTAGCGGGTGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006374.3-1993s1c1
Sequence:CCGGGCTCATAAGTACTTGTGTCATCTCGAGATGACACAAGTACTTATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006374.3-719s1c1
Sequence:CCGGGCAGATTAAGAGGAACACATTCTCGAGAATGTGTTCCTCTTAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006374.3-597s1c1
Sequence:CCGGCTGGATTATCTGCACTCCGAACTCGAGTTCGGAGTGCAGATAATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006374.3-1004s1c1
Sequence:CCGGGCTCCTGAAGCACAAGTTCATCTCGAGATGAACTTGTGCTTCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199937    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006374.3-1951s1c1
Sequence:CCGGGCCATAGATTTGCCTTGTGGTCTCGAGACCACAAGGCAAATCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006374.3-261s1c1
Sequence:CCGGCCTGAGGAGCTCTTCACCAAGCTCGAGCTTGGTGAAGAGCTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006374.3-567s1c1
Sequence:CCGGGCCACGATCCTGCGGGAGATTCTCGAGAATCTCCCGCAGGATCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006374
STK25 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 25
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006374.3-1058s1c1
Sequence:CCGGGGAGCTCATCGACCGCTATAACTCGAGTTATAGCGGTCGATGAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006374.3-442s1c1
Sequence:CCGGCCTACATCACCCGCTACTTTGCTCGAGCAAAGTAGCGGGTGATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006374.3-1993s1c1
Sequence:CCGGGCTCATAAGTACTTGTGTCATCTCGAGATGACACAAGTACTTATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006374.3-719s1c1
Sequence:CCGGGCAGATTAAGAGGAACACATTCTCGAGAATGTGTTCCTCTTAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006374.3-597s1c1
Sequence:CCGGCTGGATTATCTGCACTCCGAACTCGAGTTCGGAGTGCAGATAATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006374.3-1004s1c1
Sequence:CCGGGCTCCTGAAGCACAAGTTCATCTCGAGATGAACTTGTGCTTCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199937    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006374.3-1951s1c1
Sequence:CCGGGCCATAGATTTGCCTTGTGGTCTCGAGACCACAAGGCAAATCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006374.3-261s1c1
Sequence:CCGGCCTGAGGAGCTCTTCACCAAGCTCGAGCTTGGTGAAGAGCTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006374.3-567s1c1
Sequence:CCGGGCCACGATCCTGCGGGAGATTCTCGAGAATCTCCCGCAGGATCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks