EMAIL THIS PAGE TO A FRIEND

STK31

serine/threonine kinase 31

Synonyms: SGK396 TDRD8
UniProtKB ID: Q9BXU1, B4DZ06, B7WPP5, C9J4F9, Q6PCD3, Q9BXH8
Gene ID:
Human(56164) Summary: This gene is similar to a mouse gene that encodes a putative protein kinase with a tudor domain, and shows testis-specific expression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(77485) serine threonine kinase 31
Rat(500120) serine threonine kinase 31
sheep(101110052) serine/threonine kinase 31
naked mole-rat(101699055) serine/threonine kinase 31
domestic guinea pig(100713188) serine/threonine kinase 31
chicken(420621) serine/threonine kinase 31
Horse(100009696) serine/threonine kinase 31
domestic cat(101092014) serine/threonine kinase 31
dog(475256) serine/threonine kinase 31
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032944 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122833 Rosetta Predictions human pricing
NM_031414 Rosetta Predictions human pricing
NM_032944 Rosetta Predictions human pricing
XM_001056371 Rosetta Predictions rat pricing
XM_575472 Rosetta Predictions rat pricing
NM_029916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327417 predicted 2739
2 SASI_Hs02_00327418 predicted 1639
3 SASI_Hs02_00327419 predicted 1104
4 SASI_Hs02_00327420 predicted 328
5 SASI_Hs02_00327421 predicted 2074
6 SASI_Hs02_00327422 predicted 2592
7 SASI_Hs02_00327423 predicted 2986
8 SASI_Hs02_00327424 predicted 2487
9 SASI_Hs02_00327425 predicted 1755
10 SASI_Hs02_00327426 predicted 2795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141648 predicted 2745
2 SASI_Hs01_00141649 predicted 1642
3 SASI_Hs02_00358795 predicted 1116
4 SASI_Hs01_00141651 predicted 332
5 SASI_Hs02_00358796 predicted 2085
6 SASI_Hs02_00358797 predicted 2601
7 SASI_Hs01_00141654 predicted 2990
8 SASI_Hs02_00358798 predicted 2490
9 SASI_Hs01_00141656 predicted 1757
10 SASI_Hs01_00141657 predicted 2801
11 SASI_Hs01_00141650 predicted 1458
12 SASI_Hs01_00141652 predicted 1582
13 SASI_Hs01_00141653 predicted 2975
14 SASI_Hs01_00141655 predicted 1909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135092 predicted 2991
2 SASI_Hs01_00135093 predicted 1884
3 SASI_Hs02_00360566 predicted 1353
4 SASI_Hs01_00135095 predicted 576
5 SASI_Hs02_00360567 predicted 2335
6 SASI_Hs02_00360568 predicted 2838
7 SASI_Hs01_00135098 predicted 3239
8 SASI_Hs02_00360569 predicted 2736
9 SASI_Hs01_00135100 predicted 2007
10 SASI_Hs01_00135101 predicted 3046
11 SASI_Hs01_00135094 predicted 1834
12 SASI_Hs01_00135096 predicted 1964
13 SASI_Hs01_00135097 predicted 3349
14 SASI_Hs01_00135099 predicted 2292
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283065 predicted 203
2 SASI_Rn02_00283066 predicted 880
3 SASI_Rn02_00283067 predicted 1288
4 SASI_Rn02_00283068 predicted 2483
5 SASI_Rn02_00283069 predicted 2740
6 SASI_Rn02_00283070 predicted 2563
7 SASI_Rn02_00283071 predicted 1885
8 SASI_Rn02_00283072 predicted 2015
9 SASI_Rn02_00283073 predicted 2425
10 SASI_Rn02_00283074 predicted 2026
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575472 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403712 predicted 219
2 SASI_Rn02_00403713 predicted 899
3 SASI_Rn02_00403714 predicted 1312
4 SASI_Rn02_00403715 predicted 2494
5 SASI_Rn02_00403716 predicted 2754
6 SASI_Rn02_00403717 predicted 2573
7 SASI_Rn02_00403718 predicted 1899
8 SASI_Rn02_00403719 predicted 2035
9 SASI_Rn02_00403720 predicted 2438
10 SASI_Rn02_00403721 predicted 2045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058138 predicted 1655
2 SASI_Mm01_00058139 predicted 501
3 SASI_Mm01_00058140 predicted 294
4 SASI_Mm01_00058142 predicted 2444
5 SASI_Mm01_00058143 predicted 2761
6 SASI_Mm01_00058144 predicted 2579
7 SASI_Mm01_00058145 predicted 1899
8 SASI_Mm01_00058146 predicted 2963
9 SASI_Mm02_00336173 predicted 1064
10 SASI_Mm02_00336174 predicted 601
11 SASI_Mm01_00058141 predicted 2502
12 SASI_Mm01_00058147 predicted 233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029916
STK31 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 31
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029916.1-2384s1c1
Sequence:CCGGGCTAAAGAAGAGTCTGGGTTACTCGAGTAACCCAGACTCTTCTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029916.1-1120s1c1
Sequence:CCGGGCTGAAGAATTTGGCAGCTAACTCGAGTTAGCTGCCAAATTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029916.1-400s1c1
Sequence:CCGGCCGATCTGATATAGTAGAAATCTCGAGATTTCTACTATATCAGATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029916.1-3039s1c1
Sequence:CCGGGTCTGGATAGATATAGTGAAACTCGAGTTTCACTATATCTATCCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029916.1-1905s1c1
Sequence:CCGGCCAATGTGGATTACTTGCTTTCTCGAGAAAGCAAGTAATCCACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.2-848s21c1
Sequence:CCGGGCAGGCAATCACGTGACATTTCTCGAGAAATGTCACGTGATTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.1-1417s21c1
Sequence:GTACCGGACCACTTGATAAACGCTTAAACTCGAGTTTAAGCGTTTATCAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.1-2565s21c1
Sequence:CCGGCATTGCATAGTGCTAACATAACTCGAGTTATGTTAGCACTATGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.1-2449s21c1
Sequence:CCGGCTATCTGATGGTCCCATATTACTCGAGTAATATGGGACCATCAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.1-1677s21c1
Sequence:CCGGTTGGTAATATTGACGAAATTCCTCGAGGAATTTCGTCAATATTACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.1-608s21c1
Sequence:CCGGGAGTATGGCACTGTCGATATACTCGAGTATATCGACAGTGCCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.2-1483s21c1
Sequence:CCGGGGCCAAAGAAGGAACTAATAACTCGAGTTATTAGTTCCTTCTTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.2-2853s21c1
Sequence:CCGGAGTTTCATTTGGATGATAATGCTCGAGCATTATCATCCAAATGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029916
STK31 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 31
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029916.1-2384s1c1
Sequence:CCGGGCTAAAGAAGAGTCTGGGTTACTCGAGTAACCCAGACTCTTCTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029916.1-1120s1c1
Sequence:CCGGGCTGAAGAATTTGGCAGCTAACTCGAGTTAGCTGCCAAATTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029916.1-400s1c1
Sequence:CCGGCCGATCTGATATAGTAGAAATCTCGAGATTTCTACTATATCAGATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029916.1-3039s1c1
Sequence:CCGGGTCTGGATAGATATAGTGAAACTCGAGTTTCACTATATCTATCCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029916.1-1905s1c1
Sequence:CCGGCCAATGTGGATTACTTGCTTTCTCGAGAAAGCAAGTAATCCACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.2-848s21c1
Sequence:CCGGGCAGGCAATCACGTGACATTTCTCGAGAAATGTCACGTGATTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.1-1417s21c1
Sequence:GTACCGGACCACTTGATAAACGCTTAAACTCGAGTTTAAGCGTTTATCAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.1-2565s21c1
Sequence:CCGGCATTGCATAGTGCTAACATAACTCGAGTTATGTTAGCACTATGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.1-2449s21c1
Sequence:CCGGCTATCTGATGGTCCCATATTACTCGAGTAATATGGGACCATCAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.1-1677s21c1
Sequence:CCGGTTGGTAATATTGACGAAATTCCTCGAGGAATTTCGTCAATATTACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.1-608s21c1
Sequence:CCGGGAGTATGGCACTGTCGATATACTCGAGTATATCGACAGTGCCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.2-1483s21c1
Sequence:CCGGGGCCAAAGAAGGAACTAATAACTCGAGTTATTAGTTCCTTCTTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.2-2853s21c1
Sequence:CCGGAGTTTCATTTGGATGATAATGCTCGAGCATTATCATCCAAATGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029916
STK31 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 31
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029916.1-2384s1c1
Sequence:CCGGGCTAAAGAAGAGTCTGGGTTACTCGAGTAACCCAGACTCTTCTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029916.1-1120s1c1
Sequence:CCGGGCTGAAGAATTTGGCAGCTAACTCGAGTTAGCTGCCAAATTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029916.1-400s1c1
Sequence:CCGGCCGATCTGATATAGTAGAAATCTCGAGATTTCTACTATATCAGATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029916.1-3039s1c1
Sequence:CCGGGTCTGGATAGATATAGTGAAACTCGAGTTTCACTATATCTATCCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029916.1-1905s1c1
Sequence:CCGGCCAATGTGGATTACTTGCTTTCTCGAGAAAGCAAGTAATCCACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.2-848s21c1
Sequence:CCGGGCAGGCAATCACGTGACATTTCTCGAGAAATGTCACGTGATTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.1-1417s21c1
Sequence:GTACCGGACCACTTGATAAACGCTTAAACTCGAGTTTAAGCGTTTATCAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.1-2565s21c1
Sequence:CCGGCATTGCATAGTGCTAACATAACTCGAGTTATGTTAGCACTATGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.1-2449s21c1
Sequence:CCGGCTATCTGATGGTCCCATATTACTCGAGTAATATGGGACCATCAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.1-1677s21c1
Sequence:CCGGTTGGTAATATTGACGAAATTCCTCGAGGAATTTCGTCAATATTACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.1-608s21c1
Sequence:CCGGGAGTATGGCACTGTCGATATACTCGAGTATATCGACAGTGCCATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.2-1483s21c1
Sequence:CCGGGGCCAAAGAAGGAACTAATAACTCGAGTTATTAGTTCCTTCTTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029916.2-2853s21c1
Sequence:CCGGAGTTTCATTTGGATGATAATGCTCGAGCATTATCATCCAAATGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032944
VALIDATED
STK31 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 31
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032944.x-3588s1c1
Sequence:CCGGGATGTTTGGCTATGCGCTTAACTCGAGTTAAGCGCATAGCCAAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032944.x-1810s1c1
Sequence:CCGGGCAGGATTTGTCAGTCTCTTTCTCGAGAAAGAGACTGACAAATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032944.x-2284s1c1
Sequence:CCGGGCTATCCATTAAGAAGACATTCTCGAGAATGTCTTCTTAATGGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032944.x-3396s1c1
Sequence:CCGGCGGAGAACTTGGATAAATGTACTCGAGTACATTTATCCAAGTTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032944.x-3247s1c1
Sequence:CCGGCCTCTGTAGCTTGATATGTTACTCGAGTAACATATCAAGCTACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032944.1-1214s1c1
Sequence:CCGGGCAGGCAATCTTATAACATTTCTCGAGAAATGTTATAAGATTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032944.1-2858s1c1
Sequence:CCGGCAAGCCAACATGCCTTTAAATCTCGAGATTTAAAGGCATGTTGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032944.1-1259s1c1
Sequence:CCGGGACTTTAATTTAGGGTCTAACCTCGAGGTTAGACCCTAAATTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032944.1-2196s1c1
Sequence:CCGGCCACAGTACAAGCTAAGTACACTCGAGTGTACTTAGCTTGTACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032944.2-451s21c1
Sequence:CCGGTTTGGGCCCAGAGTATCAATACTCGAGTATTGATACTCTGGGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_032944.2-557s21c1
Sequence:CCGGCAAGATTTATGGTGGATTATTCTCGAGAATAATCCACCATAAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032944.2-2322s21c1
Sequence:CCGGATAACTCAGCTGCGCAATAATCTCGAGATTATTGCGCAGCTGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032944.2-1371s21c1
Sequence:CCGGTACACTCTGAAGACCTATATACTCGAGTATATAGGTCTTCAGAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032944.2-3268s21c1
Sequence:CCGGATACTGAATACACCCTATATACTCGAGTATATAGGGTGTATTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032944.2-2545s21c1
Sequence:CCGGTGGTACGTTCTGAGGTTAATGCTCGAGCATTAACCTCAGAACGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032944
VALIDATED
STK31 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 31
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032944.x-3588s1c1
Sequence:CCGGGATGTTTGGCTATGCGCTTAACTCGAGTTAAGCGCATAGCCAAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032944.x-1810s1c1
Sequence:CCGGGCAGGATTTGTCAGTCTCTTTCTCGAGAAAGAGACTGACAAATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032944.x-2284s1c1
Sequence:CCGGGCTATCCATTAAGAAGACATTCTCGAGAATGTCTTCTTAATGGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032944.x-3396s1c1
Sequence:CCGGCGGAGAACTTGGATAAATGTACTCGAGTACATTTATCCAAGTTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032944.x-3247s1c1
Sequence:CCGGCCTCTGTAGCTTGATATGTTACTCGAGTAACATATCAAGCTACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032944.1-1214s1c1
Sequence:CCGGGCAGGCAATCTTATAACATTTCTCGAGAAATGTTATAAGATTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032944.1-2858s1c1
Sequence:CCGGCAAGCCAACATGCCTTTAAATCTCGAGATTTAAAGGCATGTTGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032944.1-1259s1c1
Sequence:CCGGGACTTTAATTTAGGGTCTAACCTCGAGGTTAGACCCTAAATTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032944.1-2196s1c1
Sequence:CCGGCCACAGTACAAGCTAAGTACACTCGAGTGTACTTAGCTTGTACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032944.2-451s21c1
Sequence:CCGGTTTGGGCCCAGAGTATCAATACTCGAGTATTGATACTCTGGGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_032944.2-557s21c1
Sequence:CCGGCAAGATTTATGGTGGATTATTCTCGAGAATAATCCACCATAAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032944.2-2322s21c1
Sequence:CCGGATAACTCAGCTGCGCAATAATCTCGAGATTATTGCGCAGCTGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032944.2-1371s21c1
Sequence:CCGGTACACTCTGAAGACCTATATACTCGAGTATATAGGTCTTCAGAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032944.2-3268s21c1
Sequence:CCGGATACTGAATACACCCTATATACTCGAGTATATAGGGTGTATTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032944.2-2545s21c1
Sequence:CCGGTGGTACGTTCTGAGGTTAATGCTCGAGCATTAACCTCAGAACGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032944
VALIDATED
STK31 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 31
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032944.x-3588s1c1
Sequence:CCGGGATGTTTGGCTATGCGCTTAACTCGAGTTAAGCGCATAGCCAAACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_032944.x-1810s1c1
Sequence:CCGGGCAGGATTTGTCAGTCTCTTTCTCGAGAAAGAGACTGACAAATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032944.x-2284s1c1
Sequence:CCGGGCTATCCATTAAGAAGACATTCTCGAGAATGTCTTCTTAATGGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032944.x-3396s1c1
Sequence:CCGGCGGAGAACTTGGATAAATGTACTCGAGTACATTTATCCAAGTTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_032944.x-3247s1c1
Sequence:CCGGCCTCTGTAGCTTGATATGTTACTCGAGTAACATATCAAGCTACAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032944.1-1214s1c1
Sequence:CCGGGCAGGCAATCTTATAACATTTCTCGAGAAATGTTATAAGATTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032944.1-2858s1c1
Sequence:CCGGCAAGCCAACATGCCTTTAAATCTCGAGATTTAAAGGCATGTTGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032944.1-1259s1c1
Sequence:CCGGGACTTTAATTTAGGGTCTAACCTCGAGGTTAGACCCTAAATTAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032944.1-2196s1c1
Sequence:CCGGCCACAGTACAAGCTAAGTACACTCGAGTGTACTTAGCTTGTACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032944.2-451s21c1
Sequence:CCGGTTTGGGCCCAGAGTATCAATACTCGAGTATTGATACTCTGGGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_032944.2-557s21c1
Sequence:CCGGCAAGATTTATGGTGGATTATTCTCGAGAATAATCCACCATAAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032944.2-2322s21c1
Sequence:CCGGATAACTCAGCTGCGCAATAATCTCGAGATTATTGCGCAGCTGAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032944.2-1371s21c1
Sequence:CCGGTACACTCTGAAGACCTATATACTCGAGTATATAGGTCTTCAGAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032944.2-3268s21c1
Sequence:CCGGATACTGAATACACCCTATATACTCGAGTATATAGGGTGTATTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032944.2-2545s21c1
Sequence:CCGGTGGTACGTTCTGAGGTTAATGCTCGAGCATTAACCTCAGAACGTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks