EMAIL THIS PAGE TO A FRIEND

STK32A

serine/threonine kinase 32A

Synonyms: YANK1
UniProtKB ID: Q8WU08, B3KSY0
Gene ID:
Mouse(269019) serine/threonine kinase 32A
Rat(364858) serine/threonine kinase 32A
chicken(416351) serine/threonine kinase 32A
Horse(100071924) serine/threonine kinase 32A
domestic cat(101084680) serine/threonine kinase 32A
dog(487203) serine/threonine kinase 32A
domestic guinea pig(100732145) serine/threonine kinase 32A
naked mole-rat(101702341) serine/threonine kinase 32A
cow(100125774) serine/threonine kinase 32A
sheep(101114354) serine/threonine kinase 32A
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145001 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145001 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145001 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001112724 Rosetta Predictions human pricing
NM_145001 Rosetta Predictions human pricing
XM_001068554 Rosetta Predictions rat pricing
XM_344677 Rosetta Predictions rat pricing
NM_178749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325475 predicted 410
2 SASI_Hs02_00325476 predicted 519
3 SASI_Hs02_00325477 predicted 276
4 SASI_Hs02_00325478 predicted 357
5 SASI_Hs02_00325479 predicted 457
6 SASI_Hs02_00325480 predicted 523
7 SASI_Hs02_00325481 predicted 378
8 SASI_Hs02_00325482 predicted 331
9 SASI_Hs02_00325483 predicted 331
10 SASI_Hs02_00325484 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115959 predicted 408
2 SASI_Hs02_00364837 predicted 517
3 SASI_Hs02_00364838 predicted 280
4 SASI_Hs02_00364839 predicted 355
5 SASI_Hs01_00115962 predicted 463
6 SASI_Hs01_00115963 predicted 525
7 SASI_Hs02_00364840 predicted 376
8 SASI_Hs01_00115964 predicted 336
9 SASI_Hs01_00115965 predicted 326
10 SASI_Hs02_00364841 predicted 380
11 SASI_Hs01_00115960 predicted 521
12 SASI_Hs01_00115961 predicted 556
13 SASI_Hs01_00115966 predicted 449
14 SASI_Hs01_00115967 predicted 432
15 SASI_Hs01_00115968 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324912 predicted 1518
2 SASI_Rn02_00324913 predicted 1183
3 SASI_Rn02_00324914 predicted 1071
4 SASI_Rn02_00324915 predicted 770
5 SASI_Rn02_00324916 predicted 940
6 SASI_Rn02_00324917 predicted 1304
7 SASI_Rn02_00324918 predicted 1159
8 SASI_Rn02_00324919 predicted 1168
9 SASI_Rn02_00324920 predicted 527
10 SASI_Rn02_00324921 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344677 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397437 predicted 1523
2 SASI_Rn01_00179584 predicted 1178
3 SASI_Rn01_00179585 predicted 1062
4 SASI_Rn02_00397438 predicted 943
5 SASI_Rn01_00179587 predicted 1303
6 SASI_Rn01_00179588 predicted 1153
7 SASI_Rn01_00179591 predicted 1161
8 SASI_Rn01_00179592 predicted 1607
9 SASI_Rn02_00397439 predicted 1240
10 SASI_Rn02_00397440 predicted 478
11 SASI_Rn01_00179586 predicted 1591
12 SASI_Rn01_00179589 predicted 1245
13 SASI_Rn01_00179590 predicted 1268
14 SASI_Rn01_00179593 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039058 predicted 372
2 SASI_Mm01_00039059 predicted 675
3 SASI_Mm01_00039060 predicted 960
4 SASI_Mm01_00039061 predicted 1066
5 SASI_Mm01_00039062 predicted 659
6 SASI_Mm01_00039063 predicted 1411
7 SASI_Mm01_00039064 predicted 290
8 SASI_Mm01_00039065 predicted 1197
9 SASI_Mm01_00039066 predicted 494
10 SASI_Mm01_00039067 predicted 948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178749
STK32A MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 32A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178749.3-1419s21c1
Sequence:CCGGGCCAGAATAACAACCTATAAACTCGAGTTTATAGGTTGTTATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178749.3-1678s21c1
Sequence:CCGGGTGACCTTAAGTGAATCATTTCTCGAGAAATGATTCACTTAAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178749.3-1727s21c1
Sequence:CCGGTTGGAAGGTAGAGGGATATTTCTCGAGAAATATCCCTCTACCTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178749.2-1418s1c1
Sequence:CCGGCGGCCAGAATAACAACCTATACTCGAGTATAGGTTGTTATTCTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178749.2-1076s1c1
Sequence:CCGGCCCTTACATGAGTGACATGAACTCGAGTTCATGTCACTCATGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178749.2-351s1c1
Sequence:CCGGGTCTGCATTGTGCGGAAGAATCTCGAGATTCTTCCGCACAATGCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178749.2-423s1c1
Sequence:CCGGGAGCGGAATGAAGTGAGGAATCTCGAGATTCCTCACTTCATTCCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178749.2-662s1c1
Sequence:CCGGGCGCATCATTCACAGGGATATCTCGAGATATCCCTGTGAATGATGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178749
STK32A MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 32A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178749.3-1419s21c1
Sequence:CCGGGCCAGAATAACAACCTATAAACTCGAGTTTATAGGTTGTTATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178749.3-1678s21c1
Sequence:CCGGGTGACCTTAAGTGAATCATTTCTCGAGAAATGATTCACTTAAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178749.3-1727s21c1
Sequence:CCGGTTGGAAGGTAGAGGGATATTTCTCGAGAAATATCCCTCTACCTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178749.2-1418s1c1
Sequence:CCGGCGGCCAGAATAACAACCTATACTCGAGTATAGGTTGTTATTCTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178749.2-1076s1c1
Sequence:CCGGCCCTTACATGAGTGACATGAACTCGAGTTCATGTCACTCATGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178749.2-351s1c1
Sequence:CCGGGTCTGCATTGTGCGGAAGAATCTCGAGATTCTTCCGCACAATGCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178749.2-423s1c1
Sequence:CCGGGAGCGGAATGAAGTGAGGAATCTCGAGATTCCTCACTTCATTCCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178749.2-662s1c1
Sequence:CCGGGCGCATCATTCACAGGGATATCTCGAGATATCCCTGTGAATGATGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178749
STK32A MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 32A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178749.3-1419s21c1
Sequence:CCGGGCCAGAATAACAACCTATAAACTCGAGTTTATAGGTTGTTATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178749.3-1678s21c1
Sequence:CCGGGTGACCTTAAGTGAATCATTTCTCGAGAAATGATTCACTTAAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178749.3-1727s21c1
Sequence:CCGGTTGGAAGGTAGAGGGATATTTCTCGAGAAATATCCCTCTACCTTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178749.2-1418s1c1
Sequence:CCGGCGGCCAGAATAACAACCTATACTCGAGTATAGGTTGTTATTCTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178749.2-1076s1c1
Sequence:CCGGCCCTTACATGAGTGACATGAACTCGAGTTCATGTCACTCATGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178749.2-351s1c1
Sequence:CCGGGTCTGCATTGTGCGGAAGAATCTCGAGATTCTTCCGCACAATGCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178749.2-423s1c1
Sequence:CCGGGAGCGGAATGAAGTGAGGAATCTCGAGATTCCTCACTTCATTCCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178749.2-662s1c1
Sequence:CCGGGCGCATCATTCACAGGGATATCTCGAGATATCCCTGTGAATGATGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145001
STK32A MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 32A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145001.1-565s1c1
Sequence:CCGGGCTCTTCATCTGTGAGCTGGTCTCGAGACCAGCTCACAGATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145001.1-242s1c1
Sequence:CCGGGATGTCAACTTTGACCACTTTCTCGAGAAAGTGGTCAAAGTTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145001.1-340s1c1
Sequence:CCGGCGCAATGAAGTACATGAATAACTCGAGTTATTCATGTACTTCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145001.1-670s1c1
Sequence:CCGGCTGGCTCTCCTACAAGTCCCACTCGAGTGGGACTTGTAGGAGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145001.1-430s1c1
Sequence:CCGGGCACCCTTTCCTGGTTAATTTCTCGAGAAATTAACCAGGAAAGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145001.1-438s1c1
Sequence:CCGGTCCTGGTTAATTTGTGGTATTCTCGAGAATACCACAAATTAACCAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145001.1-374s1c1
Sequence:CCGGGAGCGCAATGAAGTGAGAAATCTCGAGATTTCTCACTTCATTGCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145001.1-316s1c1
Sequence:CCGGGAAGAATGATACCAAGAAGATCTCGAGATCTTCTTGGTATCATTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145001.1-529s1c1
Sequence:CCGGGCAACAGAACGTCCACTTCAACTCGAGTTGAAGTGGACGTTCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145001
STK32A MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 32A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145001.1-565s1c1
Sequence:CCGGGCTCTTCATCTGTGAGCTGGTCTCGAGACCAGCTCACAGATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145001.1-242s1c1
Sequence:CCGGGATGTCAACTTTGACCACTTTCTCGAGAAAGTGGTCAAAGTTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145001.1-340s1c1
Sequence:CCGGCGCAATGAAGTACATGAATAACTCGAGTTATTCATGTACTTCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145001.1-670s1c1
Sequence:CCGGCTGGCTCTCCTACAAGTCCCACTCGAGTGGGACTTGTAGGAGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145001.1-430s1c1
Sequence:CCGGGCACCCTTTCCTGGTTAATTTCTCGAGAAATTAACCAGGAAAGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145001.1-438s1c1
Sequence:CCGGTCCTGGTTAATTTGTGGTATTCTCGAGAATACCACAAATTAACCAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145001.1-374s1c1
Sequence:CCGGGAGCGCAATGAAGTGAGAAATCTCGAGATTTCTCACTTCATTGCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145001.1-316s1c1
Sequence:CCGGGAAGAATGATACCAAGAAGATCTCGAGATCTTCTTGGTATCATTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145001.1-529s1c1
Sequence:CCGGGCAACAGAACGTCCACTTCAACTCGAGTTGAAGTGGACGTTCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145001
STK32A MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 32A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145001.1-565s1c1
Sequence:CCGGGCTCTTCATCTGTGAGCTGGTCTCGAGACCAGCTCACAGATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145001.1-242s1c1
Sequence:CCGGGATGTCAACTTTGACCACTTTCTCGAGAAAGTGGTCAAAGTTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145001.1-340s1c1
Sequence:CCGGCGCAATGAAGTACATGAATAACTCGAGTTATTCATGTACTTCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199124    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145001.1-670s1c1
Sequence:CCGGCTGGCTCTCCTACAAGTCCCACTCGAGTGGGACTTGTAGGAGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145001.1-430s1c1
Sequence:CCGGGCACCCTTTCCTGGTTAATTTCTCGAGAAATTAACCAGGAAAGGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145001.1-438s1c1
Sequence:CCGGTCCTGGTTAATTTGTGGTATTCTCGAGAATACCACAAATTAACCAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145001.1-374s1c1
Sequence:CCGGGAGCGCAATGAAGTGAGAAATCTCGAGATTTCTCACTTCATTGCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145001.1-316s1c1
Sequence:CCGGGAAGAATGATACCAAGAAGATCTCGAGATCTTCTTGGTATCATTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145001.1-529s1c1
Sequence:CCGGGCAACAGAACGTCCACTTCAACTCGAGTTGAAGTGGACGTTCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks