EMAIL THIS PAGE TO A FRIEND

STK32B

serine/threonine kinase 32B

Synonyms: HSA250839 STK32 STKG6 YANK2
UniProtKB ID: Q9NY57, Q6UXH3, Q8IY14
Gene ID:
Mouse(64293) serine/threonine kinase 32B
Rat(305431) serine/threonine kinase 32B
cow(529134) serine/threonine kinase 32B
sheep(101103155) serine/threonine kinase 32B
naked mole-rat(101707813) serine/threonine kinase 32B
Domestic Rabbit(100358054) serine/threonine kinase 32B
domestic guinea pig(100731986) serine/threonine kinase 32B
chicken(422850) serine/threonine kinase 32B
domestic cat(101100302) serine/threonine kinase 32B
Horse(100069961) serine/threonine kinase 32B
dog(611147) serine/threonine kinase 32B
136 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018401 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050841 MISSION® esiRNA esiRNA human STK32B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018401 Rosetta Predictions human pricing
NM_001107224 Rosetta Predictions rat pricing
NM_022416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182022 predicted 962
2 SASI_Hs02_00351894 predicted 977
3 SASI_Hs02_00351895 predicted 896
4 SASI_Hs01_00182023 predicted 535
5 SASI_Hs01_00182024 predicted 1143
6 SASI_Hs01_00182025 predicted 1157
7 SASI_Hs02_00351896 predicted 993
8 SASI_Hs01_00182026 predicted 539
9 SASI_Hs01_00182027 predicted 996
10 SASI_Hs01_00182028 predicted 1006
11 SASI_Hs01_00182029 predicted 965
12 SASI_Hs01_00182030 predicted 406
13 SASI_Hs01_00182031 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226735 predicted 510
2 SASI_Rn02_00226736 predicted 1466
3 SASI_Rn02_00226737 predicted 937
4 SASI_Rn02_00226738 predicted 1310
5 SASI_Rn02_00226739 predicted 1326
6 SASI_Rn02_00226740 predicted 442
7 SASI_Rn02_00226741 predicted 473
8 SASI_Rn02_00226742 predicted 805
9 SASI_Rn02_00226743 predicted 1085
10 SASI_Rn02_00226744 predicted 1337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172299 predicted 402
2 SASI_Mm01_00172300 predicted 1178
3 SASI_Mm01_00172301 predicted 715
4 SASI_Mm01_00172302 predicted 1423
5 SASI_Mm01_00172303 predicted 1348
6 SASI_Mm01_00172304 predicted 978
7 SASI_Mm01_00172305 predicted 380
8 SASI_Mm01_00172306 predicted 1219
9 SASI_Mm01_00172307 predicted 612
10 SASI_Mm01_00172308 predicted 1235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022416
STK32B MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 32B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022416.1-404s1c1
Sequence:CCGGCGAGACACAAAGAAGATGTATCTCGAGATACATCTTCTTTGTGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022416.1-842s1c1
Sequence:CCGGCCTGAAGTCTTCCAGGTGTATCTCGAGATACACCTGGAAGACTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022416.1-1363s1c1
Sequence:CCGGCATCATATTCAACCGAGAGAACTCGAGTTCTCTCGGTTGAATATGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022416.1-1180s1c1
Sequence:CCGGGCCCAATAAAGGGAGACTGAACTCGAGTTCAGTCTCCCTTTATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022416.2-1442s21c1
Sequence:CCGGCGGAAAGAGTTCATCATATTCCTCGAGGAATATGATGAACTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022416.2-408s21c1
Sequence:CCGGAGAACGAAGAAGTCAACTTTGCTCGAGCAAAGTTGACTTCTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022416.2-1508s21c1
Sequence:CCGGTCAGACCTGGATGGCCGAATACTCGAGTATTCGGCCATCCAGGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022416
STK32B MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 32B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022416.1-404s1c1
Sequence:CCGGCGAGACACAAAGAAGATGTATCTCGAGATACATCTTCTTTGTGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022416.1-842s1c1
Sequence:CCGGCCTGAAGTCTTCCAGGTGTATCTCGAGATACACCTGGAAGACTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022416.1-1363s1c1
Sequence:CCGGCATCATATTCAACCGAGAGAACTCGAGTTCTCTCGGTTGAATATGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022416.1-1180s1c1
Sequence:CCGGGCCCAATAAAGGGAGACTGAACTCGAGTTCAGTCTCCCTTTATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022416.2-1442s21c1
Sequence:CCGGCGGAAAGAGTTCATCATATTCCTCGAGGAATATGATGAACTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022416.2-408s21c1
Sequence:CCGGAGAACGAAGAAGTCAACTTTGCTCGAGCAAAGTTGACTTCTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022416.2-1508s21c1
Sequence:CCGGTCAGACCTGGATGGCCGAATACTCGAGTATTCGGCCATCCAGGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022416
STK32B MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 32B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022416.1-404s1c1
Sequence:CCGGCGAGACACAAAGAAGATGTATCTCGAGATACATCTTCTTTGTGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022416.1-842s1c1
Sequence:CCGGCCTGAAGTCTTCCAGGTGTATCTCGAGATACACCTGGAAGACTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022416.1-1363s1c1
Sequence:CCGGCATCATATTCAACCGAGAGAACTCGAGTTCTCTCGGTTGAATATGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022416.1-1180s1c1
Sequence:CCGGGCCCAATAAAGGGAGACTGAACTCGAGTTCAGTCTCCCTTTATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022416.2-1442s21c1
Sequence:CCGGCGGAAAGAGTTCATCATATTCCTCGAGGAATATGATGAACTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022416.2-408s21c1
Sequence:CCGGAGAACGAAGAAGTCAACTTTGCTCGAGCAAAGTTGACTTCTTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022416.2-1508s21c1
Sequence:CCGGTCAGACCTGGATGGCCGAATACTCGAGTATTCGGCCATCCAGGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018401
VALIDATED
STK32B MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 32B
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.x-185s1c1
Sequence:CCGGCAGAAGCGAGACACTAAGAAACTCGAGTTTCTTAGTGTCTCGCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.x-570s1c1
Sequence:CCGGCGGTAGTGAAAGGAGCAGAAACTCGAGTTTCTGCTCCTTTCACTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.x-1686s1c1
Sequence:CCGGCCAAAGCAATCAAACCGTCATCTCGAGATGACGGTTTGATTGCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018401.x-554s1c1
Sequence:CCGGGACTTCAACATAGCGACGGTACTCGAGTACCGTCGCTATGTTGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.x-992s1c1
Sequence:CCGGGATCCCACATTTGAGCTTGAACTCGAGTTCAAGCTCAAATGTGGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.1-901s1c1
Sequence:CCGGCGTGCCCTACTTGGCCGACATCTCGAGATGTCGGCCAAGTAGGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018401.1-632s1c1
Sequence:CCGGGAAGTATTCCAGGTGTACATGCTCGAGCATGTACACCTGGAATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.1-2826s1c1
Sequence:CCGGCCATGTCATCTCTTAGATTTCCTCGAGGAAATCTAAGAGATGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.1-1013s1c1
Sequence:CCGGGAGATGATTCTAGAATCCAAGCTCGAGCTTGGATTCTAGAATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018401.1-2929s1c1
Sequence:CCGGCGAGACTATTTCTGGATTGTGCTCGAGCACAATCCAGAAATAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.1-400s1c1
Sequence:CCGGGCAGCAGAATGTGCATTTCACCTCGAGGTGAAATGCACATTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018401.1-400s21c1
Sequence:CCGGGCAGCAGAATGTGCATTTCACCTCGAGGTGAAATGCACATTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018401.1-2826s21c1
Sequence:CCGGCCATGTCATCTCTTAGATTTCCTCGAGGAAATCTAAGAGATGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018401.1-185s21c1
Sequence:CCGGCAGAAGCGAGACACTAAGAAACTCGAGTTTCTTAGTGTCTCGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018401.1-1013s21c1
Sequence:CCGGGAGATGATTCTAGAATCCAAGCTCGAGCTTGGATTCTAGAATCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018401
VALIDATED
STK32B MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 32B
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.x-185s1c1
Sequence:CCGGCAGAAGCGAGACACTAAGAAACTCGAGTTTCTTAGTGTCTCGCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.x-570s1c1
Sequence:CCGGCGGTAGTGAAAGGAGCAGAAACTCGAGTTTCTGCTCCTTTCACTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.x-1686s1c1
Sequence:CCGGCCAAAGCAATCAAACCGTCATCTCGAGATGACGGTTTGATTGCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018401.x-554s1c1
Sequence:CCGGGACTTCAACATAGCGACGGTACTCGAGTACCGTCGCTATGTTGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.x-992s1c1
Sequence:CCGGGATCCCACATTTGAGCTTGAACTCGAGTTCAAGCTCAAATGTGGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.1-901s1c1
Sequence:CCGGCGTGCCCTACTTGGCCGACATCTCGAGATGTCGGCCAAGTAGGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018401.1-632s1c1
Sequence:CCGGGAAGTATTCCAGGTGTACATGCTCGAGCATGTACACCTGGAATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.1-2826s1c1
Sequence:CCGGCCATGTCATCTCTTAGATTTCCTCGAGGAAATCTAAGAGATGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.1-1013s1c1
Sequence:CCGGGAGATGATTCTAGAATCCAAGCTCGAGCTTGGATTCTAGAATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018401.1-2929s1c1
Sequence:CCGGCGAGACTATTTCTGGATTGTGCTCGAGCACAATCCAGAAATAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.1-400s1c1
Sequence:CCGGGCAGCAGAATGTGCATTTCACCTCGAGGTGAAATGCACATTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018401.1-400s21c1
Sequence:CCGGGCAGCAGAATGTGCATTTCACCTCGAGGTGAAATGCACATTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018401.1-2826s21c1
Sequence:CCGGCCATGTCATCTCTTAGATTTCCTCGAGGAAATCTAAGAGATGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018401.1-185s21c1
Sequence:CCGGCAGAAGCGAGACACTAAGAAACTCGAGTTTCTTAGTGTCTCGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018401.1-1013s21c1
Sequence:CCGGGAGATGATTCTAGAATCCAAGCTCGAGCTTGGATTCTAGAATCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018401
VALIDATED
STK32B MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 32B
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.x-185s1c1
Sequence:CCGGCAGAAGCGAGACACTAAGAAACTCGAGTTTCTTAGTGTCTCGCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.x-570s1c1
Sequence:CCGGCGGTAGTGAAAGGAGCAGAAACTCGAGTTTCTGCTCCTTTCACTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.x-1686s1c1
Sequence:CCGGCCAAAGCAATCAAACCGTCATCTCGAGATGACGGTTTGATTGCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018401.x-554s1c1
Sequence:CCGGGACTTCAACATAGCGACGGTACTCGAGTACCGTCGCTATGTTGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.x-992s1c1
Sequence:CCGGGATCCCACATTTGAGCTTGAACTCGAGTTCAAGCTCAAATGTGGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.1-901s1c1
Sequence:CCGGCGTGCCCTACTTGGCCGACATCTCGAGATGTCGGCCAAGTAGGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018401.1-632s1c1
Sequence:CCGGGAAGTATTCCAGGTGTACATGCTCGAGCATGTACACCTGGAATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.1-2826s1c1
Sequence:CCGGCCATGTCATCTCTTAGATTTCCTCGAGGAAATCTAAGAGATGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.1-1013s1c1
Sequence:CCGGGAGATGATTCTAGAATCCAAGCTCGAGCTTGGATTCTAGAATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018401.1-2929s1c1
Sequence:CCGGCGAGACTATTTCTGGATTGTGCTCGAGCACAATCCAGAAATAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_018401.1-400s1c1
Sequence:CCGGGCAGCAGAATGTGCATTTCACCTCGAGGTGAAATGCACATTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018401.1-400s21c1
Sequence:CCGGGCAGCAGAATGTGCATTTCACCTCGAGGTGAAATGCACATTCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342550    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018401.1-2826s21c1
Sequence:CCGGCCATGTCATCTCTTAGATTTCCTCGAGGAAATCTAAGAGATGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018401.1-185s21c1
Sequence:CCGGCAGAAGCGAGACACTAAGAAACTCGAGTTTCTTAGTGTCTCGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018401.1-1013s21c1
Sequence:CCGGGAGATGATTCTAGAATCCAAGCTCGAGCTTGGATTCTAGAATCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks