EMAIL THIS PAGE TO A FRIEND

STK32C

serine/threonine kinase 32C

Synonyms: PKE RP11-140A10.1 YANK3
UniProtKB ID: Q86UX6, Q5T0Q5, Q86UE1
Gene ID:
Human(282974) Summary: The protein encoded by this gene is a member of the serine/threonine protein kinase family. The specific function of this kinase is not known. [provided by RefSeq, Jul 2008]
Mouse(57740) serine/threonine kinase 32C
Rat(365381) serine/threonine kinase 32C
chicken(769291) serine/threonine kinase 32C
Horse(100051389) serine/threonine kinase 32C
domestic cat(101086850) serine/threonine kinase 32C
dog(491589) serine/threonine kinase 32C
domestic guinea pig(100730416) serine/threonine kinase 32C
naked mole-rat(101708138) serine/threonine kinase 32C
cow(524218) serine/threonine kinase 32C
sheep(101109232) serine/threonine kinase 32C
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021302 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021302 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021302 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173575 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173575 Rosetta Predictions human pricing
NM_001108922 Rosetta Predictions rat pricing
NM_021302 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118506 predicted 823
2 SASI_Hs01_00118508 predicted 1382
3 SASI_Hs01_00118509 predicted 830
4 SASI_Hs02_00368417 predicted 1898
5 SASI_Hs01_00118511 predicted 713
6 SASI_Hs01_00118512 predicted 811
7 SASI_Hs01_00118513 predicted 944
8 SASI_Hs01_00118514 predicted 900
9 SASI_Hs01_00118515 predicted 816
10 SASI_Hs02_00368418 predicted 1250
11 SASI_Hs01_00118507 predicted 921
12 SASI_Hs01_00118510 predicted 1734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243404 predicted 486
2 SASI_Rn02_00243405 predicted 1867
3 SASI_Rn02_00243406 predicted 796
4 SASI_Rn02_00243407 predicted 1306
5 SASI_Rn02_00243408 predicted 1847
6 SASI_Rn02_00243409 predicted 924
7 SASI_Rn02_00243410 predicted 337
8 SASI_Rn02_00243411 predicted 910
9 SASI_Rn02_00243412 predicted 815
10 SASI_Rn02_00243413 predicted 1311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135264 predicted 447
2 SASI_Mm01_00135265 predicted 1345
3 SASI_Mm01_00135267 predicted 796
4 SASI_Mm02_00325837 predicted 276
5 SASI_Mm01_00135269 predicted 873
6 SASI_Mm01_00135270 predicted 1219
7 SASI_Mm01_00135271 predicted 1267
8 SASI_Mm01_00135272 predicted 476
9 SASI_Mm01_00135273 predicted 996
10 SASI_Mm02_00325838 predicted 302
11 SASI_Mm01_00135266 predicted 1834
12 SASI_Mm01_00135268 predicted 1842
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021302
STK32C MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 32C
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021302.3-1853s21c1
Sequence:CCGGACTGTAGGTTGGCAGATTATACTCGAGTATAATCTGCCAACCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021302.3-1493s21c1
Sequence:CCGGAGGCCCAGAGACGTCAGATATCTCGAGATATCTGACGTCTCTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021302.3-1420s21c1
Sequence:CCGGTCCAGCAAGACTTCGTGATTTCTCGAGAAATCACGAAGTCTTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021302.3-839s21c1
Sequence:CCGGCAACATTGCCACCATCATAAACTCGAGTTTATGATGGTGGCAATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021302.1-805s1c1
Sequence:CCGGCACCTTACTGACTTCAACATTCTCGAGAATGTTGAAGTCAGTAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021302.1-390s1c1
Sequence:CCGGCTTCCAGATTCTGAGAGCAATCTCGAGATTGCTCTCAGAATCTGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021302.1-1363s1c1
Sequence:CCGGTCGGAGAATGACTACCTGCAACTCGAGTTGCAGGTAGTCATTCTCCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021302.1-1484s1c1
Sequence:CCGGCGTCAGATATGACAGATTCCACTCGAGTGGAATCTGTCATATCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021302
STK32C MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 32C
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021302.3-1853s21c1
Sequence:CCGGACTGTAGGTTGGCAGATTATACTCGAGTATAATCTGCCAACCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021302.3-1493s21c1
Sequence:CCGGAGGCCCAGAGACGTCAGATATCTCGAGATATCTGACGTCTCTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021302.3-1420s21c1
Sequence:CCGGTCCAGCAAGACTTCGTGATTTCTCGAGAAATCACGAAGTCTTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021302.3-839s21c1
Sequence:CCGGCAACATTGCCACCATCATAAACTCGAGTTTATGATGGTGGCAATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021302.1-805s1c1
Sequence:CCGGCACCTTACTGACTTCAACATTCTCGAGAATGTTGAAGTCAGTAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021302.1-390s1c1
Sequence:CCGGCTTCCAGATTCTGAGAGCAATCTCGAGATTGCTCTCAGAATCTGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021302.1-1363s1c1
Sequence:CCGGTCGGAGAATGACTACCTGCAACTCGAGTTGCAGGTAGTCATTCTCCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021302.1-1484s1c1
Sequence:CCGGCGTCAGATATGACAGATTCCACTCGAGTGGAATCTGTCATATCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021302
STK32C MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 32C
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021302.3-1853s21c1
Sequence:CCGGACTGTAGGTTGGCAGATTATACTCGAGTATAATCTGCCAACCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021302.3-1493s21c1
Sequence:CCGGAGGCCCAGAGACGTCAGATATCTCGAGATATCTGACGTCTCTGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021302.3-1420s21c1
Sequence:CCGGTCCAGCAAGACTTCGTGATTTCTCGAGAAATCACGAAGTCTTGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021302.3-839s21c1
Sequence:CCGGCAACATTGCCACCATCATAAACTCGAGTTTATGATGGTGGCAATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021302.1-805s1c1
Sequence:CCGGCACCTTACTGACTTCAACATTCTCGAGAATGTTGAAGTCAGTAAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021302.1-390s1c1
Sequence:CCGGCTTCCAGATTCTGAGAGCAATCTCGAGATTGCTCTCAGAATCTGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021302.1-1363s1c1
Sequence:CCGGTCGGAGAATGACTACCTGCAACTCGAGTTGCAGGTAGTCATTCTCCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021302.1-1484s1c1
Sequence:CCGGCGTCAGATATGACAGATTCCACTCGAGTGGAATCTGTCATATCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173575
VALIDATED
STK32C MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 32C
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173575.2-825s1c1
Sequence:CCGGCATGCACACCTGACCGACTTCCTCGAGGAAGTCGGTCAGGTGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173575.2-311s21c1
Sequence:CCGGCCTGTTTCAGTGGAGCAAGTGCTCGAGCACTTGCTCCACTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173575.2-839s21c1
Sequence:CCGGCGACTTCAACATTGCCACCATCTCGAGATGGTGGCAATGTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173575.2-1898s21c1
Sequence:CCGGCAGGAGTCTTTGTCCCTGCTCCTCGAGGAGCAGGGACAAAGACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173575.2-1386s21c1
Sequence:CCGGCAGTCCGAGAATGACTATCTTCTCGAGAAGATAGTCATTCTCGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173575.2-722s21c1
Sequence:CCGGGCTGTACATCTGCGAGATGGCCTCGAGGCCATCTCGCAGATGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173575.2-419s1c1
Sequence:CCGGCCAGATCCTTCGGGCCATTGGCTCGAGCCAATGGCCCGAAGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173575.2-1727s1c1
Sequence:CCGGCCGGACACATTTCACACCTCACTCGAGTGAGGTGTGAAATGTGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-311s1c1
Sequence:CCGGCCTGTTTCAGTGGAGCAAGTGCTCGAGCACTTGCTCCACTGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-1898s1c1
Sequence:CCGGCAGGAGTCTTTGTCCCTGCTCCTCGAGGAGCAGGGACAAAGACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-722s1c1
Sequence:CCGGGCTGTACATCTGCGAGATGGCCTCGAGGCCATCTCGCAGATGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-1991s1c1
Sequence:CCGGGCTCAGGTCTTGGAGGTCAAGCTCGAGCTTGACCTCCAAGACCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-839s1c1
Sequence:CCGGCGACTTCAACATTGCCACCATCTCGAGATGGTGGCAATGTTGAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-795s1c1
Sequence:CCGGCCTGACAACATTCTCCTGGATCTCGAGATCCAGGAGAATGTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-1325s1c1
Sequence:CCGGGCACAAGAAGAAGAAGCGTCTCTCGAGAGACGCTTCTTCTTCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-1386s1c1
Sequence:CCGGCAGTCCGAGAATGACTATCTTCTCGAGAAGATAGTCATTCTCGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-1940s1c1
Sequence:CCGGCCTCGTCACAAGGTGACCCTTCTCGAGAAGGGTCACCTTGTGACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173575
VALIDATED
STK32C MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 32C
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173575.2-825s1c1
Sequence:CCGGCATGCACACCTGACCGACTTCCTCGAGGAAGTCGGTCAGGTGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173575.2-311s21c1
Sequence:CCGGCCTGTTTCAGTGGAGCAAGTGCTCGAGCACTTGCTCCACTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173575.2-839s21c1
Sequence:CCGGCGACTTCAACATTGCCACCATCTCGAGATGGTGGCAATGTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173575.2-1898s21c1
Sequence:CCGGCAGGAGTCTTTGTCCCTGCTCCTCGAGGAGCAGGGACAAAGACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173575.2-1386s21c1
Sequence:CCGGCAGTCCGAGAATGACTATCTTCTCGAGAAGATAGTCATTCTCGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173575.2-722s21c1
Sequence:CCGGGCTGTACATCTGCGAGATGGCCTCGAGGCCATCTCGCAGATGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173575.2-419s1c1
Sequence:CCGGCCAGATCCTTCGGGCCATTGGCTCGAGCCAATGGCCCGAAGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173575.2-1727s1c1
Sequence:CCGGCCGGACACATTTCACACCTCACTCGAGTGAGGTGTGAAATGTGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-311s1c1
Sequence:CCGGCCTGTTTCAGTGGAGCAAGTGCTCGAGCACTTGCTCCACTGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-1898s1c1
Sequence:CCGGCAGGAGTCTTTGTCCCTGCTCCTCGAGGAGCAGGGACAAAGACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-722s1c1
Sequence:CCGGGCTGTACATCTGCGAGATGGCCTCGAGGCCATCTCGCAGATGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-1991s1c1
Sequence:CCGGGCTCAGGTCTTGGAGGTCAAGCTCGAGCTTGACCTCCAAGACCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-839s1c1
Sequence:CCGGCGACTTCAACATTGCCACCATCTCGAGATGGTGGCAATGTTGAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-795s1c1
Sequence:CCGGCCTGACAACATTCTCCTGGATCTCGAGATCCAGGAGAATGTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-1325s1c1
Sequence:CCGGGCACAAGAAGAAGAAGCGTCTCTCGAGAGACGCTTCTTCTTCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-1386s1c1
Sequence:CCGGCAGTCCGAGAATGACTATCTTCTCGAGAAGATAGTCATTCTCGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-1940s1c1
Sequence:CCGGCCTCGTCACAAGGTGACCCTTCTCGAGAAGGGTCACCTTGTGACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173575
VALIDATED
STK32C MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 32C
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173575.2-825s1c1
Sequence:CCGGCATGCACACCTGACCGACTTCCTCGAGGAAGTCGGTCAGGTGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173575.2-311s21c1
Sequence:CCGGCCTGTTTCAGTGGAGCAAGTGCTCGAGCACTTGCTCCACTGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173575.2-839s21c1
Sequence:CCGGCGACTTCAACATTGCCACCATCTCGAGATGGTGGCAATGTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173575.2-1898s21c1
Sequence:CCGGCAGGAGTCTTTGTCCCTGCTCCTCGAGGAGCAGGGACAAAGACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173575.2-1386s21c1
Sequence:CCGGCAGTCCGAGAATGACTATCTTCTCGAGAAGATAGTCATTCTCGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173575.2-722s21c1
Sequence:CCGGGCTGTACATCTGCGAGATGGCCTCGAGGCCATCTCGCAGATGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173575.2-419s1c1
Sequence:CCGGCCAGATCCTTCGGGCCATTGGCTCGAGCCAATGGCCCGAAGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173575.2-1727s1c1
Sequence:CCGGCCGGACACATTTCACACCTCACTCGAGTGAGGTGTGAAATGTGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-311s1c1
Sequence:CCGGCCTGTTTCAGTGGAGCAAGTGCTCGAGCACTTGCTCCACTGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-1898s1c1
Sequence:CCGGCAGGAGTCTTTGTCCCTGCTCCTCGAGGAGCAGGGACAAAGACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-722s1c1
Sequence:CCGGGCTGTACATCTGCGAGATGGCCTCGAGGCCATCTCGCAGATGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-1991s1c1
Sequence:CCGGGCTCAGGTCTTGGAGGTCAAGCTCGAGCTTGACCTCCAAGACCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-839s1c1
Sequence:CCGGCGACTTCAACATTGCCACCATCTCGAGATGGTGGCAATGTTGAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-795s1c1
Sequence:CCGGCCTGACAACATTCTCCTGGATCTCGAGATCCAGGAGAATGTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-1325s1c1
Sequence:CCGGGCACAAGAAGAAGAAGCGTCTCTCGAGAGACGCTTCTTCTTCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-1386s1c1
Sequence:CCGGCAGTCCGAGAATGACTATCTTCTCGAGAAGATAGTCATTCTCGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_173575.2-1940s1c1
Sequence:CCGGCCTCGTCACAAGGTGACCCTTCTCGAGAAGGGTCACCTTGTGACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks