EMAIL THIS PAGE TO A FRIEND

STK33

serine/threonine kinase 33

UniProtKB ID: Q9BYT3, Q658S6, Q8NEF5
Gene ID:
Mouse(117229) serine/threonine kinase 33
Rat(690861) serine/threonine kinase 33
cow(528309) serine/threonine kinase 33
sheep(101102513) serine/threonine kinase 33
naked mole-rat(101723968) serine/threonine kinase 33
Domestic Rabbit(100342767) serine/threonine kinase 33
domestic guinea pig(100732716) serine/threonine kinase 33
Zebrafish(565828) serine/threonine kinase 33
dog(476841) serine/threonine kinase 33
Horse(100070955) serine/threonine kinase 33
domestic cat(101083704) serine/threonine kinase 33
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
S4698 Anti-STK33 (426-440) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1407920 Anti-STK33 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA015742 Anti-STK33 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1411293 Anti-STK33 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA056855 Anti-STK33 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0065975M2 Monoclonal Anti-STK33 antibody produced in mouse clone 6G1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1405260 Monoclonal Anti-STK33 antibody produced in mouse clone 4A12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409680 Monoclonal Anti-STK33 antibody produced in mouse clone 1F10, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, western blot pricing
SAB1409681 Monoclonal Anti-STK33 antibody produced in mouse clone 3F10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1409682 Monoclonal Anti-STK33 antibody produced in mouse clone 4F7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409683 Monoclonal Anti-STK33 antibody produced in mouse clone 4F7, ascites fluid, solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_358897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030906 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_054103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030906 Rosetta Predictions human pricing
XM_001075918 Rosetta Predictions rat pricing
XM_358897 Rosetta Predictions mouse pricing
XM_489715 Rosetta Predictions mouse pricing
XM_910887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046815 predicted 1734
2 SASI_Hs01_00046816 predicted 1630
3 SASI_Hs01_00046817 predicted 1191
4 SASI_Hs01_00046818 predicted 2070
5 SASI_Hs01_00046819 predicted 1669
6 SASI_Hs01_00046821 predicted 1396
7 SASI_Hs01_00046822 predicted 1170
8 SASI_Hs01_00046823 predicted 1693
9 SASI_Hs02_00358442 predicted 1634
10 SASI_Hs01_00046824 predicted 1833
11 SASI_Hs01_00046820 predicted 1907
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075918 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351489 predicted 586
2 SASI_Rn02_00351490 predicted 332
3 SASI_Rn02_00351491 predicted 318
4 SASI_Rn02_00351492 predicted 440
5 SASI_Rn02_00351493 predicted 1165
6 SASI_Rn02_00351494 predicted 1097
7 SASI_Rn02_00351495 predicted 491
8 SASI_Rn02_00351496 predicted 476
9 SASI_Rn02_00351497 predicted 1051
10 SASI_Rn02_00351498 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426279 predicted 780
2 SASI_Mm02_00426280 predicted 794
3 SASI_Mm02_00426281 predicted 598
4 SASI_Mm02_00426282 predicted 790
5 SASI_Mm02_00426283 predicted 789
6 SASI_Mm01_00226106 predicted 712
7 SASI_Mm02_00426284 predicted 1196
8 SASI_Mm02_00426285 predicted 1133
9 SASI_Mm02_00426286 predicted 838
10 SASI_Mm02_00426287 predicted 952
11 SASI_Mm01_00226097 predicted 1570
12 SASI_Mm01_00226098 predicted 1826
13 SASI_Mm01_00226099 predicted 1532
14 SASI_Mm01_00226100 predicted 1937
15 SASI_Mm01_00226101 predicted 1081
16 SASI_Mm01_00226102 predicted 1646
17 SASI_Mm01_00226103 predicted 1911
18 SASI_Mm01_00226104 predicted 1508
19 SASI_Mm01_00226105 predicted 1562
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_489715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427305 predicted 774
2 SASI_Mm02_00427306 predicted 1568
3 SASI_Mm02_00427307 predicted 1814
4 SASI_Mm02_00427308 predicted 1521
5 SASI_Mm02_00427309 predicted 1936
6 SASI_Mm02_00427310 predicted 1634
7 SASI_Mm02_00427311 predicted 1910
8 SASI_Mm02_00427312 predicted 1499
9 SASI_Mm02_00427313 predicted 1559
10 SASI_Mm02_00427314 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436002 predicted 780
2 SASI_Mm02_00436003 predicted 1568
3 SASI_Mm02_00436004 predicted 1814
4 SASI_Mm02_00436005 predicted 1517
5 SASI_Mm02_00436006 predicted 1933
6 SASI_Mm02_00436007 predicted 1639
7 SASI_Mm02_00436008 predicted 1909
8 SASI_Mm02_00436009 predicted 1496
9 SASI_Mm02_00436010 predicted 1553
10 SASI_Mm02_00436011 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358897
STK33 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 33
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358897.1-1192s1c1
Sequence:CCGGGCAGTGTGACATTTGGAGCATCTCGAGATGCTCCAAATGTCACACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358897.1-587s1c1
Sequence:CCGGCCACACATAAGAATGGACGATCTCGAGATCGTCCATTCTTATGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358897.1-427s1c1
Sequence:CCGGGAGTATTGGTAGTACAGAATTCTCGAGAATTCTGTACTACCAATACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358897.1-958s1c1
Sequence:CCGGCATCGCATATCTTCATAACAACTCGAGTTGTTATGAAGATATGCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358897.1-1451s1c1
Sequence:CCGGGCAAGACCAACCAATGTATTACTCGAGTAATACATTGGTTGGTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358897
STK33 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 33
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358897.1-1192s1c1
Sequence:CCGGGCAGTGTGACATTTGGAGCATCTCGAGATGCTCCAAATGTCACACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358897.1-587s1c1
Sequence:CCGGCCACACATAAGAATGGACGATCTCGAGATCGTCCATTCTTATGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358897.1-427s1c1
Sequence:CCGGGAGTATTGGTAGTACAGAATTCTCGAGAATTCTGTACTACCAATACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358897.1-958s1c1
Sequence:CCGGCATCGCATATCTTCATAACAACTCGAGTTGTTATGAAGATATGCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358897.1-1451s1c1
Sequence:CCGGGCAAGACCAACCAATGTATTACTCGAGTAATACATTGGTTGGTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358897
STK33 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 33
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358897.1-1192s1c1
Sequence:CCGGGCAGTGTGACATTTGGAGCATCTCGAGATGCTCCAAATGTCACACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358897.1-587s1c1
Sequence:CCGGCCACACATAAGAATGGACGATCTCGAGATCGTCCATTCTTATGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358897.1-427s1c1
Sequence:CCGGGAGTATTGGTAGTACAGAATTCTCGAGAATTCTGTACTACCAATACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358897.1-958s1c1
Sequence:CCGGCATCGCATATCTTCATAACAACTCGAGTTGTTATGAAGATATGCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358897.1-1451s1c1
Sequence:CCGGGCAAGACCAACCAATGTATTACTCGAGTAATACATTGGTTGGTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030906
VALIDATED
STK33 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 33
Human
21 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_030906.x-2398s1c1
Sequence:CCGGCCAAGGAACAGCAACCAAGTACTCGAGTACTTGGTTGCTGTTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_030906.x-2319s1c1
Sequence:CCGGGCAGTTCAAGTTTCACATCTACTCGAGTAGATGTGAAACTTGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030906.x-1145s1c1
Sequence:CCGGCCCTCAAGAACCTCAAATGTACTCGAGTACATTTGAGGTTCTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030906.x-3035s1c1
Sequence:CCGGCTTGCCATTAACTTGCTGCTACTCGAGTAGCAGCAAGTTAATGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_030906.x-1436s1c1
Sequence:CCGGGAACACATCATACATCTGGAACTCGAGTTCCAGATGTATGATGTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196915    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030906.2-2518s1c1
Sequence:CCGGGCCATACGTATTACAGCAGAACTCGAGTTCTGCTGTAATACGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030906.2-1453s1c1
Sequence:CCGGCGTCGTAATGTACATGTTATTCTCGAGAATAACATGTACATTACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030906.2-2458s1c1
Sequence:CCGGGCCAAATAATTATGTGCACTTCTCGAGAAGTGCACATAATTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030906.2-2510s21c1
Sequence:GTACCGGATAAACTTGCCATACGTATTACTCGAGTAATACGTATGGCAAGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-1002s21c1
Sequence:GTACCGGTTGAACGAGAGGTGAACATTCCTCGAGGAATGTTCACCTCTCGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030906.2-2447s21c1
Sequence:GTACCGGGTAATGGAGGTGCCAAATAATCTCGAGATTATTTGGCACCTCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-2013s21c1
Sequence:GTACCGGCAACCAAGTACCCTGCTAAATCTCGAGATTTAGCAGGGTACTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030906.2-2245s21c1
Sequence:GTACCGGTAAGCTGCACATGGCATTAAACTCGAGTTTAATGCCATGTGCAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_030906.2-2400s21c1
Sequence:GTACCGGATGTTTAGGCACAGCTATTTACTCGAGTAAATAGCTGTGCCTAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_030906.2-1404s21c1
Sequence:CCGGTTATCAGTGCCCACGACTATACTCGAGTATAGTCGTGGGCACTGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030906.2-1187s21c1
Sequence:CCGGCTCGCATCAGCTATAGCATATCTCGAGATATGCTATAGCTGATGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-938s21c1
Sequence:CCGGGAAACGAAGTGGGCAATTAAACTCGAGTTTAATTGCCCACTTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_030906.2-1454s21c1
Sequence:CCGGGTCGTAATGTACATGTTATTACTCGAGTAATAACATGTACATTACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-1265s21c1
Sequence:GTACCGGAGCAGTCTTATTGATGATAACCTCGAGGTTATCATCAATAAGACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-897s21c1
Sequence:GTACCGGGGAGCTTTGGAATAGTCATTGCTCGAGCAATGACTATTCCAAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-1161s21c1
Sequence:GTACCGGATGAGACAAGGTGGATCATTCCTCGAGGAATGATCCACCTTGTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030906
VALIDATED
STK33 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 33
Human
21 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_030906.x-2398s1c1
Sequence:CCGGCCAAGGAACAGCAACCAAGTACTCGAGTACTTGGTTGCTGTTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_030906.x-2319s1c1
Sequence:CCGGGCAGTTCAAGTTTCACATCTACTCGAGTAGATGTGAAACTTGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030906.x-1145s1c1
Sequence:CCGGCCCTCAAGAACCTCAAATGTACTCGAGTACATTTGAGGTTCTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030906.x-3035s1c1
Sequence:CCGGCTTGCCATTAACTTGCTGCTACTCGAGTAGCAGCAAGTTAATGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_030906.x-1436s1c1
Sequence:CCGGGAACACATCATACATCTGGAACTCGAGTTCCAGATGTATGATGTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196915    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030906.2-2518s1c1
Sequence:CCGGGCCATACGTATTACAGCAGAACTCGAGTTCTGCTGTAATACGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030906.2-1453s1c1
Sequence:CCGGCGTCGTAATGTACATGTTATTCTCGAGAATAACATGTACATTACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030906.2-2458s1c1
Sequence:CCGGGCCAAATAATTATGTGCACTTCTCGAGAAGTGCACATAATTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030906.2-2510s21c1
Sequence:GTACCGGATAAACTTGCCATACGTATTACTCGAGTAATACGTATGGCAAGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-1002s21c1
Sequence:GTACCGGTTGAACGAGAGGTGAACATTCCTCGAGGAATGTTCACCTCTCGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030906.2-2447s21c1
Sequence:GTACCGGGTAATGGAGGTGCCAAATAATCTCGAGATTATTTGGCACCTCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-2013s21c1
Sequence:GTACCGGCAACCAAGTACCCTGCTAAATCTCGAGATTTAGCAGGGTACTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030906.2-2245s21c1
Sequence:GTACCGGTAAGCTGCACATGGCATTAAACTCGAGTTTAATGCCATGTGCAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_030906.2-2400s21c1
Sequence:GTACCGGATGTTTAGGCACAGCTATTTACTCGAGTAAATAGCTGTGCCTAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_030906.2-1404s21c1
Sequence:CCGGTTATCAGTGCCCACGACTATACTCGAGTATAGTCGTGGGCACTGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030906.2-1187s21c1
Sequence:CCGGCTCGCATCAGCTATAGCATATCTCGAGATATGCTATAGCTGATGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-938s21c1
Sequence:CCGGGAAACGAAGTGGGCAATTAAACTCGAGTTTAATTGCCCACTTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_030906.2-1454s21c1
Sequence:CCGGGTCGTAATGTACATGTTATTACTCGAGTAATAACATGTACATTACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-1265s21c1
Sequence:GTACCGGAGCAGTCTTATTGATGATAACCTCGAGGTTATCATCAATAAGACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-897s21c1
Sequence:GTACCGGGGAGCTTTGGAATAGTCATTGCTCGAGCAATGACTATTCCAAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-1161s21c1
Sequence:GTACCGGATGAGACAAGGTGGATCATTCCTCGAGGAATGATCCACCTTGTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030906
VALIDATED
STK33 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 33
Human
21 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_030906.x-2398s1c1
Sequence:CCGGCCAAGGAACAGCAACCAAGTACTCGAGTACTTGGTTGCTGTTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_030906.x-2319s1c1
Sequence:CCGGGCAGTTCAAGTTTCACATCTACTCGAGTAGATGTGAAACTTGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030906.x-1145s1c1
Sequence:CCGGCCCTCAAGAACCTCAAATGTACTCGAGTACATTTGAGGTTCTTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002081    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030906.x-3035s1c1
Sequence:CCGGCTTGCCATTAACTTGCTGCTACTCGAGTAGCAGCAAGTTAATGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_030906.x-1436s1c1
Sequence:CCGGGAACACATCATACATCTGGAACTCGAGTTCCAGATGTATGATGTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196915    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030906.2-2518s1c1
Sequence:CCGGGCCATACGTATTACAGCAGAACTCGAGTTCTGCTGTAATACGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030906.2-1453s1c1
Sequence:CCGGCGTCGTAATGTACATGTTATTCTCGAGAATAACATGTACATTACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030906.2-2458s1c1
Sequence:CCGGGCCAAATAATTATGTGCACTTCTCGAGAAGTGCACATAATTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030906.2-2510s21c1
Sequence:GTACCGGATAAACTTGCCATACGTATTACTCGAGTAATACGTATGGCAAGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-1002s21c1
Sequence:GTACCGGTTGAACGAGAGGTGAACATTCCTCGAGGAATGTTCACCTCTCGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030906.2-2447s21c1
Sequence:GTACCGGGTAATGGAGGTGCCAAATAATCTCGAGATTATTTGGCACCTCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-2013s21c1
Sequence:GTACCGGCAACCAAGTACCCTGCTAAATCTCGAGATTTAGCAGGGTACTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030906.2-2245s21c1
Sequence:GTACCGGTAAGCTGCACATGGCATTAAACTCGAGTTTAATGCCATGTGCAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_030906.2-2400s21c1
Sequence:GTACCGGATGTTTAGGCACAGCTATTTACTCGAGTAAATAGCTGTGCCTAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_030906.2-1404s21c1
Sequence:CCGGTTATCAGTGCCCACGACTATACTCGAGTATAGTCGTGGGCACTGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030906.2-1187s21c1
Sequence:CCGGCTCGCATCAGCTATAGCATATCTCGAGATATGCTATAGCTGATGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-938s21c1
Sequence:CCGGGAAACGAAGTGGGCAATTAAACTCGAGTTTAATTGCCCACTTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_030906.2-1454s21c1
Sequence:CCGGGTCGTAATGTACATGTTATTACTCGAGTAATAACATGTACATTACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-1265s21c1
Sequence:GTACCGGAGCAGTCTTATTGATGATAACCTCGAGGTTATCATCAATAAGACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-897s21c1
Sequence:GTACCGGGGAGCTTTGGAATAGTCATTGCTCGAGCAATGACTATTCCAAAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030906.2-1161s21c1
Sequence:GTACCGGATGAGACAAGGTGGATCATTCCTCGAGGAATGATCCACCTTGTCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054103
STK33 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 33
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054103.1-1119s21c1
Sequence:CCGGTTGCATCAGCCATCGCATATCCTCGAGGATATGCGATGGCTGATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054103.1-2223s21c1
Sequence:CCGGCTCGCTTAGTTCTACTCAAATCTCGAGATTTGAGTAGAACTAAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054103.1-584s21c1
Sequence:CCGGATGTCACAGACATCGAGTATTCTCGAGAATACTCGATGTCTGTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054103
STK33 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 33
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000360780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054103.1-1119s21c1
Sequence:CCGGTTGCATCAGCCATCGCATATCCTCGAGGATATGCGATGGCTGATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054103.1-2223s21c1
Sequence:CCGGCTCGCTTAGTTCTACTCAAATCTCGAGATTTGAGTAGAACTAAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054103.1-584s21c1
Sequence:CCGGATGTCACAGACATCGAGTATTCTCGAGAATACTCGATGTCTGTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054103
STK33 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 33
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000360780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054103.1-1119s21c1
Sequence:CCGGTTGCATCAGCCATCGCATATCCTCGAGGATATGCGATGGCTGATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054103.1-2223s21c1
Sequence:CCGGCTCGCTTAGTTCTACTCAAATCTCGAGATTTGAGTAGAACTAAGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054103.1-584s21c1
Sequence:CCGGATGTCACAGACATCGAGTATTCTCGAGAATACTCGATGTCTGTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks