EMAIL THIS PAGE TO A FRIEND

STK35

serine/threonine kinase 35

Synonyms: CLIK1 STK35L1
Gene ID:
Human(140901) Summary: The protein encoded by this gene is a kinase that is predominantly found in the nucleus. However, it can interact with PDLIM1/CLP-36 in the cytoplasm and localize to actin stress fibers. The encoded protein may be a regulator of actin stress fibers in nonmuscle cells. [provided by RefSeq, Jul 2008]
Mouse(67333) serine/threonine kinase 35
Rat(311419) serine/threonine kinase 35
Zebrafish(568080) serine/threonine kinase 35
domestic cat(101084276) serine/threonine kinase 35
dog(609432) serine/threonine kinase 35
chicken(771724) serine/threonine kinase 35
domestic guinea pig(100719353) serine/threonine kinase 35
naked mole-rat(101707534) serine/threonine kinase 35
cow(540979) serine/threonine kinase 35
sheep(101114546) serine/threonine kinase 35
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183262 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183262 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183262 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080836 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080836 Rosetta Predictions human pricing
NM_001107773 Rosetta Predictions rat pricing
NM_001038635 Rosetta Predictions mouse pricing
NM_183262 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054372 predicted 1647
2 SASI_Hs01_00054374 predicted 556
3 SASI_Hs01_00054375 predicted 1145
4 SASI_Hs02_00362627 predicted 539
5 SASI_Hs01_00054376 predicted 522
6 SASI_Hs01_00054378 predicted 731
7 SASI_Hs01_00054379 predicted 435
8 SASI_Hs02_00362628 predicted 1111
9 SASI_Hs01_00054380 predicted 351
10 SASI_Hs01_00054381 predicted 491
11 SASI_Hs01_00054373 predicted 893
12 SASI_Hs01_00054377 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232125 predicted 897
2 SASI_Rn02_00232126 predicted 2380
3 SASI_Rn02_00232127 predicted 2574
4 SASI_Rn02_00232128 predicted 1839
5 SASI_Rn02_00232129 predicted 1052
6 SASI_Rn02_00232130 predicted 1889
7 SASI_Rn02_00232131 predicted 1089
8 SASI_Rn02_00232132 predicted 1089
9 SASI_Rn02_00232133 predicted 1899
10 SASI_Rn02_00232134 predicted 2197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144490 predicted 1058
2 SASI_Mm01_00144491 predicted 1156
3 SASI_Mm01_00144492 predicted 1169
4 SASI_Mm01_00144493 predicted 709
5 SASI_Mm01_00144494 predicted 774
6 SASI_Mm01_00144495 predicted 622
7 SASI_Mm02_00289638 predicted 1426
8 SASI_Mm01_00144496 predicted 1179
9 SASI_Mm01_00144497 predicted 717
10 SASI_Mm01_00144498 predicted 1162
11 SASI_Mm01_00144489 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183262 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160688 predicted 1575
2 SASI_Mm01_00160689 predicted 1509
3 SASI_Mm01_00160690 predicted 1805
4 SASI_Mm01_00160691 predicted 782
5 SASI_Mm01_00160692 predicted 959
6 SASI_Mm02_00350345 predicted 1178
7 SASI_Mm01_00160693 predicted 1326
8 SASI_Mm01_00160694 predicted 1172
9 SASI_Mm01_00160696 predicted 1298
10 SASI_Mm01_00160697 predicted 911
11 SASI_Mm01_00160695 predicted 887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183262
VALIDATED
STK35 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 35
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1077s21c1
Sequence:CCGGCGCCATTGCCTTCCTGCATAACTCGAGTTATGCAGGAAGGCAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1626s21c1
Sequence:CCGGGGTCACATGTGCTGCTTAAACCTCGAGGTTTAAGCAGCACATGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-992s21c1
Sequence:CCGGGTGAAGGTGGAGACCTCAATCCTCGAGGATTGAGGTCTCCACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-62s21c1
Sequence:CCGGCGGGAGGTGCAGCTTACATAACTCGAGTTATGTAAGCTGCACCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1314s21c1
Sequence:CCGGAGTCTGGGAGGGACACTATACCTCGAGGTATAGTGTCCCTCCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1368s21c1
Sequence:CCGGCATCTGGGCAATGATAGAAAGCTCGAGCTTTCTATCATTGCCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1489s21c1
Sequence:CCGGCCAAAGATGGAGTTGCATATCCTCGAGGATATGCAACTCCATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1600s21c1
Sequence:CCGGTTTGAACTTGAAACCCGAATGCTCGAGCATTCGGGTTTCAAGTTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183262.1-843s1c1
Sequence:CCGGGCCATTGCCTTCCTGCATAAACTCGAGTTTATGCAGGAAGGCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183262.1-1253s1c1
Sequence:CCGGCCCAAAGATGGAGTTGCATATCTCGAGATATGCAACTCCATCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183262.1-1277s1c1
Sequence:CCGGCCAGAAACGTAGGACTTCCATCTCGAGATGGAAGTCCTACGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183262.1-575s1c1
Sequence:CCGGGCACCAGAATATCGTGCAGTTCTCGAGAACTGCACGATATTCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183262.1-993s1c1
Sequence:CCGGGAGGGCAATCAAGATAACAAACTCGAGTTTGTTATCTTGATTGCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183262
VALIDATED
STK35 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 35
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1077s21c1
Sequence:CCGGCGCCATTGCCTTCCTGCATAACTCGAGTTATGCAGGAAGGCAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1626s21c1
Sequence:CCGGGGTCACATGTGCTGCTTAAACCTCGAGGTTTAAGCAGCACATGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-992s21c1
Sequence:CCGGGTGAAGGTGGAGACCTCAATCCTCGAGGATTGAGGTCTCCACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-62s21c1
Sequence:CCGGCGGGAGGTGCAGCTTACATAACTCGAGTTATGTAAGCTGCACCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1314s21c1
Sequence:CCGGAGTCTGGGAGGGACACTATACCTCGAGGTATAGTGTCCCTCCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1368s21c1
Sequence:CCGGCATCTGGGCAATGATAGAAAGCTCGAGCTTTCTATCATTGCCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1489s21c1
Sequence:CCGGCCAAAGATGGAGTTGCATATCCTCGAGGATATGCAACTCCATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1600s21c1
Sequence:CCGGTTTGAACTTGAAACCCGAATGCTCGAGCATTCGGGTTTCAAGTTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183262.1-843s1c1
Sequence:CCGGGCCATTGCCTTCCTGCATAAACTCGAGTTTATGCAGGAAGGCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183262.1-1253s1c1
Sequence:CCGGCCCAAAGATGGAGTTGCATATCTCGAGATATGCAACTCCATCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183262.1-1277s1c1
Sequence:CCGGCCAGAAACGTAGGACTTCCATCTCGAGATGGAAGTCCTACGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183262.1-575s1c1
Sequence:CCGGGCACCAGAATATCGTGCAGTTCTCGAGAACTGCACGATATTCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183262.1-993s1c1
Sequence:CCGGGAGGGCAATCAAGATAACAAACTCGAGTTTGTTATCTTGATTGCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183262
VALIDATED
STK35 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 35
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1077s21c1
Sequence:CCGGCGCCATTGCCTTCCTGCATAACTCGAGTTATGCAGGAAGGCAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1626s21c1
Sequence:CCGGGGTCACATGTGCTGCTTAAACCTCGAGGTTTAAGCAGCACATGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-992s21c1
Sequence:CCGGGTGAAGGTGGAGACCTCAATCCTCGAGGATTGAGGTCTCCACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-62s21c1
Sequence:CCGGCGGGAGGTGCAGCTTACATAACTCGAGTTATGTAAGCTGCACCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1314s21c1
Sequence:CCGGAGTCTGGGAGGGACACTATACCTCGAGGTATAGTGTCCCTCCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1368s21c1
Sequence:CCGGCATCTGGGCAATGATAGAAAGCTCGAGCTTTCTATCATTGCCCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1489s21c1
Sequence:CCGGCCAAAGATGGAGTTGCATATCCTCGAGGATATGCAACTCCATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183262.3-1600s21c1
Sequence:CCGGTTTGAACTTGAAACCCGAATGCTCGAGCATTCGGGTTTCAAGTTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183262.1-843s1c1
Sequence:CCGGGCCATTGCCTTCCTGCATAAACTCGAGTTTATGCAGGAAGGCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183262.1-1253s1c1
Sequence:CCGGCCCAAAGATGGAGTTGCATATCTCGAGATATGCAACTCCATCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183262.1-1277s1c1
Sequence:CCGGCCAGAAACGTAGGACTTCCATCTCGAGATGGAAGTCCTACGTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_183262.1-575s1c1
Sequence:CCGGGCACCAGAATATCGTGCAGTTCTCGAGAACTGCACGATATTCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183262.1-993s1c1
Sequence:CCGGGAGGGCAATCAAGATAACAAACTCGAGTTTGTTATCTTGATTGCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080836
STK35 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 35
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219656    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080836.2-3870s1c1
Sequence:CCGGTGCCCAAGTTCTAGTAGTATTCTCGAGAATACTACTAGAACTTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080836.2-3393s1c1
Sequence:CCGGGGTCTAGTAGCTCTAACTAAACTCGAGTTTAGTTAGAGCTACTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080836.2-640s1c1
Sequence:CCGGGCCATTGCCTTCCTGCACAAACTCGAGTTTGTGCAGGAAGGCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080836.2-240s1c1
Sequence:CCGGCGGCGTGGTTTATGAGGCAGTCTCGAGACTGCCTCATAAACCACGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080836.2-444s1c1
Sequence:CCGGCAACAAGAGCTCGCAGCTTTACTCGAGTAAAGCTGCGAGCTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080836.x-814s1c1
Sequence:CCGGGTGAATGTGAATAAGTACTGGCTCGAGCCAGTACTTATTCACATTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080836.x-790s1c1
Sequence:CCGGGAGGGCAATCAAGACAACAAACTCGAGTTTGTTGTCTTGATTGCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080836.x-1164s1c1
Sequence:CCGGTGAACTTGAAACCAGAATGGACTCGAGTCCATTCTGGTTTCAAGTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080836.x-524s1c1
Sequence:CCGGCCTGCTATCTCTGGTTTGTCACTCGAGTGACAAACCAGAGATAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080836
STK35 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 35
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219656    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080836.2-3870s1c1
Sequence:CCGGTGCCCAAGTTCTAGTAGTATTCTCGAGAATACTACTAGAACTTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080836.2-3393s1c1
Sequence:CCGGGGTCTAGTAGCTCTAACTAAACTCGAGTTTAGTTAGAGCTACTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080836.2-640s1c1
Sequence:CCGGGCCATTGCCTTCCTGCACAAACTCGAGTTTGTGCAGGAAGGCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080836.2-240s1c1
Sequence:CCGGCGGCGTGGTTTATGAGGCAGTCTCGAGACTGCCTCATAAACCACGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080836.2-444s1c1
Sequence:CCGGCAACAAGAGCTCGCAGCTTTACTCGAGTAAAGCTGCGAGCTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080836.x-814s1c1
Sequence:CCGGGTGAATGTGAATAAGTACTGGCTCGAGCCAGTACTTATTCACATTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080836.x-790s1c1
Sequence:CCGGGAGGGCAATCAAGACAACAAACTCGAGTTTGTTGTCTTGATTGCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080836.x-1164s1c1
Sequence:CCGGTGAACTTGAAACCAGAATGGACTCGAGTCCATTCTGGTTTCAAGTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080836.x-524s1c1
Sequence:CCGGCCTGCTATCTCTGGTTTGTCACTCGAGTGACAAACCAGAGATAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080836
STK35 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 35
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219656    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080836.2-3870s1c1
Sequence:CCGGTGCCCAAGTTCTAGTAGTATTCTCGAGAATACTACTAGAACTTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080836.2-3393s1c1
Sequence:CCGGGGTCTAGTAGCTCTAACTAAACTCGAGTTTAGTTAGAGCTACTAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080836.2-640s1c1
Sequence:CCGGGCCATTGCCTTCCTGCACAAACTCGAGTTTGTGCAGGAAGGCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199133    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080836.2-240s1c1
Sequence:CCGGCGGCGTGGTTTATGAGGCAGTCTCGAGACTGCCTCATAAACCACGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080836.2-444s1c1
Sequence:CCGGCAACAAGAGCTCGCAGCTTTACTCGAGTAAAGCTGCGAGCTCTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080836.x-814s1c1
Sequence:CCGGGTGAATGTGAATAAGTACTGGCTCGAGCCAGTACTTATTCACATTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080836.x-790s1c1
Sequence:CCGGGAGGGCAATCAAGACAACAAACTCGAGTTTGTTGTCTTGATTGCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080836.x-1164s1c1
Sequence:CCGGTGAACTTGAAACCAGAATGGACTCGAGTCCATTCTGGTTTCAAGTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080836.x-524s1c1
Sequence:CCGGCCTGCTATCTCTGGTTTGTCACTCGAGTGACAAACCAGAGATAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks