EMAIL THIS PAGE TO A FRIEND

STK36

serine/threonine kinase 36

Synonyms: FU
UniProtKB ID: Q9NRP7, B7WPM3, Q8TC32, Q9H9N9, Q9UF35, Q9ULE2
Gene ID:
Human(27148) Summary: This gene encodes a member of the serine/threonine kinase family of enzymes. This family member is similar to a Drosophila protein that plays a key role in the Hedgehog signaling pathway. This human protein is a positive regulator of the GLI zinc-finger transcription factors. Knockout studies of the homologous mouse gene suggest that defects in this human gene may lead to congenital hydrocephalus, possibly due to a functional defect in motile cilia. Because Hedgehog signaling is frequently activated in certain kinds of gastrointestinal cancers, it has been suggested that this gene is a target for the treatment of these cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(269209) serine/threonine kinase 36
Rat(301516) serine/threonine kinase 36
Zebrafish(566154) serine/threonine kinase 36 (fused homolog, Drosophila)
chicken(424210) serine/threonine kinase 36, fused homolog (Drosophila)
dog(478913) serine/threonine kinase 36
domestic cat(101091390) serine/threonine kinase 36
cow(508408) serine/threonine kinase 36
sheep(101112457) serine/threonine kinase 36
naked mole-rat(101701098) serine/threonine kinase 36
domestic guinea pig(100725817) serine/threonine kinase 36
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015690 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137991 MISSION® esiRNA esiRNA human STK36 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015690 Rosetta Predictions human pricing
XM_001058046 Rosetta Predictions rat pricing
XM_217435 Rosetta Predictions rat pricing
NM_175031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191156 predicted 2175
2 SASI_Hs01_00191157 predicted 1312
3 SASI_Hs01_00191158 predicted 2813
4 SASI_Hs02_00348342 predicted 2628
5 SASI_Hs01_00191160 predicted 264
6 SASI_Hs02_00348343 predicted 580
7 SASI_Hs01_00191161 predicted 3053
8 SASI_Hs01_00191162 predicted 1100
9 SASI_Hs01_00191163 predicted 394
10 SASI_Hs01_00191164 predicted 484
11 SASI_Hs01_00191159 predicted 1051
12 SASI_Hs01_00191165 predicted 1788
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058046 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288395 predicted 3996
2 SASI_Rn02_00288396 predicted 743
3 SASI_Rn02_00288397 predicted 3394
4 SASI_Rn02_00288398 predicted 2206
5 SASI_Rn02_00288399 predicted 915
6 SASI_Rn02_00288400 predicted 2013
7 SASI_Rn02_00288401 predicted 673
8 SASI_Rn02_00288402 predicted 3440
9 SASI_Rn02_00288403 predicted 2887
10 SASI_Rn02_00288404 predicted 2479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217435 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377168 predicted 626
2 SASI_Rn02_00377169 predicted 740
3 SASI_Rn02_00377170 predicted 2211
4 SASI_Rn02_00377171 predicted 919
5 SASI_Rn02_00377172 predicted 2017
6 SASI_Rn02_00377173 predicted 668
7 SASI_Rn02_00377174 predicted 389
8 SASI_Rn02_00377175 predicted 2010
9 SASI_Rn02_00377176 predicted 669
10 SASI_Rn02_00377177 predicted 2533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345637 predicted 1306
2 SASI_Mm01_00167751 predicted 1997
3 SASI_Mm01_00167752 predicted 3439
4 SASI_Mm01_00167753 predicted 2198
5 SASI_Mm01_00167754 predicted 2026
6 SASI_Mm01_00167755 predicted 2491
7 SASI_Mm01_00167756 predicted 4106
8 SASI_Mm01_00167757 predicted 1691
9 SASI_Mm01_00167758 predicted 4185
10 SASI_Mm01_00167759 predicted 2465
11 SASI_Mm01_00167750 predicted 2772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175031
STK36 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 36
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175031.2-1517s1c1
Sequence:CCGGCCTGTTGTGTAACCCTGACTTCTCGAGAAGTCAGGGTTACACAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175031.2-377s1c1
Sequence:CCGGGCATCCCAACATTGTGCATATCTCGAGATATGCACAATGTTGGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175031.2-2726s1c1
Sequence:CCGGGCCGTATAGTTGTGGCTTCTACTCGAGTAGAAGCCACAACTATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175031.2-2443s1c1
Sequence:CCGGGCAAGGTGAAAGTAGCAGATTCTCGAGAATCTGCTACTTTCACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175031.2-1113s1c1
Sequence:CCGGGCCTGTAAACTCATGGCTGAACTCGAGTTCAGCCATGAGTTTACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175031.3-3919s21c1
Sequence:CCGGGATTGGGCAAGGAGCTATTAACTCGAGTTAATAGCTCCTTGCCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175031.3-727s21c1
Sequence:CCGGTCAAAGGCACACCGCTCTATACTCGAGTATAGAGCGGTGTGCCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175031.3-2401s21c1
Sequence:CCGGTCTACGCCTGCTGCTATATTACTCGAGTAATATAGCAGCAGGCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175031
STK36 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 36
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175031.2-1517s1c1
Sequence:CCGGCCTGTTGTGTAACCCTGACTTCTCGAGAAGTCAGGGTTACACAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175031.2-377s1c1
Sequence:CCGGGCATCCCAACATTGTGCATATCTCGAGATATGCACAATGTTGGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175031.2-2726s1c1
Sequence:CCGGGCCGTATAGTTGTGGCTTCTACTCGAGTAGAAGCCACAACTATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175031.2-2443s1c1
Sequence:CCGGGCAAGGTGAAAGTAGCAGATTCTCGAGAATCTGCTACTTTCACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175031.2-1113s1c1
Sequence:CCGGGCCTGTAAACTCATGGCTGAACTCGAGTTCAGCCATGAGTTTACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175031.3-3919s21c1
Sequence:CCGGGATTGGGCAAGGAGCTATTAACTCGAGTTAATAGCTCCTTGCCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175031.3-727s21c1
Sequence:CCGGTCAAAGGCACACCGCTCTATACTCGAGTATAGAGCGGTGTGCCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175031.3-2401s21c1
Sequence:CCGGTCTACGCCTGCTGCTATATTACTCGAGTAATATAGCAGCAGGCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175031
STK36 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 36
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175031.2-1517s1c1
Sequence:CCGGCCTGTTGTGTAACCCTGACTTCTCGAGAAGTCAGGGTTACACAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175031.2-377s1c1
Sequence:CCGGGCATCCCAACATTGTGCATATCTCGAGATATGCACAATGTTGGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175031.2-2726s1c1
Sequence:CCGGGCCGTATAGTTGTGGCTTCTACTCGAGTAGAAGCCACAACTATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175031.2-2443s1c1
Sequence:CCGGGCAAGGTGAAAGTAGCAGATTCTCGAGAATCTGCTACTTTCACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175031.2-1113s1c1
Sequence:CCGGGCCTGTAAACTCATGGCTGAACTCGAGTTCAGCCATGAGTTTACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175031.3-3919s21c1
Sequence:CCGGGATTGGGCAAGGAGCTATTAACTCGAGTTAATAGCTCCTTGCCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175031.3-727s21c1
Sequence:CCGGTCAAAGGCACACCGCTCTATACTCGAGTATAGAGCGGTGTGCCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175031.3-2401s21c1
Sequence:CCGGTCTACGCCTGCTGCTATATTACTCGAGTAATATAGCAGCAGGCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015690
VALIDATED
STK36 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 36
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015690.2-4384s1c1
Sequence:CCGGGCCAGAGAAGAGTCCTTTCTTCTCGAGAAGAAAGGACTCTTCTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015690.2-588s1c1
Sequence:CCGGCCGAGATATGAAGCCTCAGAACTCGAGTTCTGAGGCTTCATATCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015690.2-1284s1c1
Sequence:CCGGCGGGATCTTAGCCTCAGAATTCTCGAGAATTCTGAGGCTAAGATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015690.2-1053s1c1
Sequence:CCGGCCCAGAACTTCAGGTCCTAAACTCGAGTTTAGGACCTGAAGTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-3252s21c1
Sequence:GTACCGGATGGATGCTGACCTCCTTATACTCGAGTATAAGGAGGTCAGCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-2620s21c1
Sequence:GTACCGGGTGACGTTGCTACTCTCTTTACTCGAGTAAAGAGAGTAGCAACGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-403s21c1
Sequence:GTACCGGGGAATTTGCAACGAGAGATTGCTCGAGCAATCTCTCGTTGCAAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015690.3-4683s21c1
Sequence:GTACCGGATTATCCCTTAGCCAACATTCCTCGAGGAATGTTGGCTAAGGGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-1167s21c1
Sequence:CCGGATCTTGACTCAGGCCTATAAACTCGAGTTTATAGGCCTGAGTCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015690.3-1029s21c1
Sequence:CCGGGCTGGTCATGTCACCATAATACTCGAGTATTATGGTGACATGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015690.3-1331s21c1
Sequence:CCGGCGGGATCTTAGCCTCAGAATTCTCGAGAATTCTGAGGCTAAGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-819s21c1
Sequence:CCGGTCTGTTGGCTGCATACTATATCTCGAGATATAGTATGCAGCCAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-4657s21c1
Sequence:CCGGATGCCATCAGTCCCTGTTATTCTCGAGAATAACAGGGACTGATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015690
VALIDATED
STK36 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 36
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015690.2-4384s1c1
Sequence:CCGGGCCAGAGAAGAGTCCTTTCTTCTCGAGAAGAAAGGACTCTTCTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015690.2-588s1c1
Sequence:CCGGCCGAGATATGAAGCCTCAGAACTCGAGTTCTGAGGCTTCATATCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015690.2-1284s1c1
Sequence:CCGGCGGGATCTTAGCCTCAGAATTCTCGAGAATTCTGAGGCTAAGATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015690.2-1053s1c1
Sequence:CCGGCCCAGAACTTCAGGTCCTAAACTCGAGTTTAGGACCTGAAGTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-3252s21c1
Sequence:GTACCGGATGGATGCTGACCTCCTTATACTCGAGTATAAGGAGGTCAGCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-2620s21c1
Sequence:GTACCGGGTGACGTTGCTACTCTCTTTACTCGAGTAAAGAGAGTAGCAACGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-403s21c1
Sequence:GTACCGGGGAATTTGCAACGAGAGATTGCTCGAGCAATCTCTCGTTGCAAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015690.3-4683s21c1
Sequence:GTACCGGATTATCCCTTAGCCAACATTCCTCGAGGAATGTTGGCTAAGGGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-1167s21c1
Sequence:CCGGATCTTGACTCAGGCCTATAAACTCGAGTTTATAGGCCTGAGTCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015690.3-1029s21c1
Sequence:CCGGGCTGGTCATGTCACCATAATACTCGAGTATTATGGTGACATGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015690.3-1331s21c1
Sequence:CCGGCGGGATCTTAGCCTCAGAATTCTCGAGAATTCTGAGGCTAAGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-819s21c1
Sequence:CCGGTCTGTTGGCTGCATACTATATCTCGAGATATAGTATGCAGCCAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-4657s21c1
Sequence:CCGGATGCCATCAGTCCCTGTTATTCTCGAGAATAACAGGGACTGATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015690
VALIDATED
STK36 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 36
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015690.2-4384s1c1
Sequence:CCGGGCCAGAGAAGAGTCCTTTCTTCTCGAGAAGAAAGGACTCTTCTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015690.2-588s1c1
Sequence:CCGGCCGAGATATGAAGCCTCAGAACTCGAGTTCTGAGGCTTCATATCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015690.2-1284s1c1
Sequence:CCGGCGGGATCTTAGCCTCAGAATTCTCGAGAATTCTGAGGCTAAGATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015690.2-1053s1c1
Sequence:CCGGCCCAGAACTTCAGGTCCTAAACTCGAGTTTAGGACCTGAAGTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-3252s21c1
Sequence:GTACCGGATGGATGCTGACCTCCTTATACTCGAGTATAAGGAGGTCAGCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-2620s21c1
Sequence:GTACCGGGTGACGTTGCTACTCTCTTTACTCGAGTAAAGAGAGTAGCAACGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-403s21c1
Sequence:GTACCGGGGAATTTGCAACGAGAGATTGCTCGAGCAATCTCTCGTTGCAAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015690.3-4683s21c1
Sequence:GTACCGGATTATCCCTTAGCCAACATTCCTCGAGGAATGTTGGCTAAGGGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-1167s21c1
Sequence:CCGGATCTTGACTCAGGCCTATAAACTCGAGTTTATAGGCCTGAGTCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015690.3-1029s21c1
Sequence:CCGGGCTGGTCATGTCACCATAATACTCGAGTATTATGGTGACATGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015690.3-1331s21c1
Sequence:CCGGCGGGATCTTAGCCTCAGAATTCTCGAGAATTCTGAGGCTAAGATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-819s21c1
Sequence:CCGGTCTGTTGGCTGCATACTATATCTCGAGATATAGTATGCAGCCAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015690.3-4657s21c1
Sequence:CCGGATGCCATCAGTCCCTGTTATTCTCGAGAATAACAGGGACTGATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks