EMAIL THIS PAGE TO A FRIEND

STK38

serine/threonine kinase 38

Synonyms: NDR NDR1
UniProtKB ID: Q15208, Q503A1
Gene ID:
Mouse(106504) serine/threonine kinase 38
Rat(361813) serine/threonine kinase 38
domestic guinea pig(100722460) serine/threonine kinase 38
naked mole-rat(101712141) serine/threonine kinase 38
Domestic Rabbit(100346979) serine/threonine kinase 38
cow(533677) serine/threonine kinase 38
chicken(428260) serine/threonine kinase 38
domestic cat(101080969) serine/threonine kinase 38
Horse(100063891) serine/threonine kinase 38
dog(481766) serine/threonine kinase 38
192 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501750 Anti-STK38 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, human, rat, canine, bovine
ELISA, western blot pricing
SAB2501883 Anti-STK38 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, bovine, human, rat, pig, canine
ELISA, western blot pricing
AV48727 Anti-STK38 antibody produced in rabbit affinity isolated antibody rabbit, rat, zebrafish, mouse, human, guinea pig, horse, canine, bovine,
western blot pricing
SAB1410182 Anti-STK38 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
WH0011329M1 Monoclonal Anti-STK38 antibody produced in mouse clone 2G8-1F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1408832 Monoclonal Anti-STK38 antibody produced in mouse clone 3A5, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1408833 Monoclonal Anti-STK38 antibody produced in mouse clone 6F1, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB1408834 Monoclonal Anti-STK38 antibody produced in mouse clone 2F3, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, western blot pricing
SAB1408835 Monoclonal Anti-STK38 antibody produced in mouse clone 6G11, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
SAB1404930 Monoclonal Anti-STK38, (C-terminal) antibody produced in mouse clone 2F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134115 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134115 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134115 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007271 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007271 Rosetta Predictions human pricing
NM_001015025 Rosetta Predictions rat pricing
NM_134115 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224995 predicted 875
2 SASI_Hs01_00224996 predicted 375
3 SASI_Hs02_00343321 predicted 437
4 SASI_Hs01_00224997 predicted 974
5 SASI_Hs01_00224998 predicted 559
6 SASI_Hs01_00224999 predicted 1653
7 SASI_Hs01_00225000 predicted 324
8 SASI_Hs01_00225001 predicted 755
9 SASI_Hs01_00225002 predicted 506
10 SASI_Hs01_00225003 predicted 641
11 SASI_Hs01_00225004 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202103 predicted 919
2 SASI_Rn02_00202104 predicted 1097
3 SASI_Rn02_00202105 predicted 938
4 SASI_Rn02_00202106 predicted 449
5 SASI_Rn02_00202107 predicted 529
6 SASI_Rn02_00202108 predicted 494
7 SASI_Rn02_00202109 predicted 609
8 SASI_Rn02_00202110 predicted 348
9 SASI_Rn02_00202111 predicted 1030
10 SASI_Rn02_00202112 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134115 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077001 predicted 737
2 SASI_Mm02_00339360 predicted 1704
3 SASI_Mm01_00077002 predicted 656
4 SASI_Mm01_00077003 predicted 1096
5 SASI_Mm01_00077004 predicted 814
6 SASI_Mm01_00077006 predicted 439
7 SASI_Mm01_00077007 predicted 699
8 SASI_Mm01_00077008 predicted 1065
9 SASI_Mm01_00077009 predicted 1112
10 SASI_Mm01_00077010 predicted 819
11 SASI_Mm01_00077005 predicted 1714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134115
VALIDATED
STK38 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 38
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134115.2-2010s21c1
Sequence:CCGGTGCCAAGCCCACCAAGTATTTCTCGAGAAATACTTGGTGGGCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134115.2-1406s21c1
Sequence:CCGGAGACCAGCTGCGATATCTATTCTCGAGAATAGATATCGCAGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134115.2-706s21c1
Sequence:CCGGGCTAAACCTCTACCTAATCATCTCGAGATGATTAGGTAGAGGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134115.2-256s21c1
Sequence:CCGGCTCATCCATGAGTAATCATACCTCGAGGTATGATTACTCATGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134115.2-1757s21c1
Sequence:CCGGTGTGATTGTAAGTGGATATTCCTCGAGGAATATCCACTTACAATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134115.2-338s21c1
Sequence:CCGGCAACATGAAGAACGAGAAATGCTCGAGCATTTCTCGTTCTTCATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134115.2-1595s21c1
Sequence:CCGGGCCATACCTTCGTACATGAAACTCGAGTTTCATGTACGAAGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134115.1-1595s1c1
Sequence:CCGGGCCATACCTTCGTACATGAAACTCGAGTTTCATGTACGAAGGTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134115.1-1445s1c1
Sequence:CCGGGATACCTCAAACTTCGATGAACTCGAGTTCATCGAAGTTTGAGGTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134115.1-1207s1c1
Sequence:CCGGCCCACAAGAGACATACAAGAACTCGAGTTCTTGTATGTCTCTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134115.1-440s1c1
Sequence:CCGGCGGAAGGAAACAGAGTTTCTTCTCGAGAAGAAACTCTGTTTCCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134115.1-706s1c1
Sequence:CCGGGCTAAACCTCTACCTAATCATCTCGAGATGATTAGGTAGAGGTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134115
VALIDATED
STK38 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 38
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134115.2-2010s21c1
Sequence:CCGGTGCCAAGCCCACCAAGTATTTCTCGAGAAATACTTGGTGGGCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134115.2-1406s21c1
Sequence:CCGGAGACCAGCTGCGATATCTATTCTCGAGAATAGATATCGCAGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134115.2-706s21c1
Sequence:CCGGGCTAAACCTCTACCTAATCATCTCGAGATGATTAGGTAGAGGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134115.2-256s21c1
Sequence:CCGGCTCATCCATGAGTAATCATACCTCGAGGTATGATTACTCATGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134115.2-1757s21c1
Sequence:CCGGTGTGATTGTAAGTGGATATTCCTCGAGGAATATCCACTTACAATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134115.2-338s21c1
Sequence:CCGGCAACATGAAGAACGAGAAATGCTCGAGCATTTCTCGTTCTTCATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134115.2-1595s21c1
Sequence:CCGGGCCATACCTTCGTACATGAAACTCGAGTTTCATGTACGAAGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134115.1-1595s1c1
Sequence:CCGGGCCATACCTTCGTACATGAAACTCGAGTTTCATGTACGAAGGTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134115.1-1445s1c1
Sequence:CCGGGATACCTCAAACTTCGATGAACTCGAGTTCATCGAAGTTTGAGGTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134115.1-1207s1c1
Sequence:CCGGCCCACAAGAGACATACAAGAACTCGAGTTCTTGTATGTCTCTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134115.1-440s1c1
Sequence:CCGGCGGAAGGAAACAGAGTTTCTTCTCGAGAAGAAACTCTGTTTCCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134115.1-706s1c1
Sequence:CCGGGCTAAACCTCTACCTAATCATCTCGAGATGATTAGGTAGAGGTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134115
VALIDATED
STK38 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 38
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134115.2-2010s21c1
Sequence:CCGGTGCCAAGCCCACCAAGTATTTCTCGAGAAATACTTGGTGGGCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134115.2-1406s21c1
Sequence:CCGGAGACCAGCTGCGATATCTATTCTCGAGAATAGATATCGCAGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134115.2-706s21c1
Sequence:CCGGGCTAAACCTCTACCTAATCATCTCGAGATGATTAGGTAGAGGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134115.2-256s21c1
Sequence:CCGGCTCATCCATGAGTAATCATACCTCGAGGTATGATTACTCATGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134115.2-1757s21c1
Sequence:CCGGTGTGATTGTAAGTGGATATTCCTCGAGGAATATCCACTTACAATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134115.2-338s21c1
Sequence:CCGGCAACATGAAGAACGAGAAATGCTCGAGCATTTCTCGTTCTTCATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134115.2-1595s21c1
Sequence:CCGGGCCATACCTTCGTACATGAAACTCGAGTTTCATGTACGAAGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134115.1-1595s1c1
Sequence:CCGGGCCATACCTTCGTACATGAAACTCGAGTTTCATGTACGAAGGTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134115.1-1445s1c1
Sequence:CCGGGATACCTCAAACTTCGATGAACTCGAGTTCATCGAAGTTTGAGGTATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134115.1-1207s1c1
Sequence:CCGGCCCACAAGAGACATACAAGAACTCGAGTTCTTGTATGTCTCTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134115.1-440s1c1
Sequence:CCGGCGGAAGGAAACAGAGTTTCTTCTCGAGAAGAAACTCTGTTTCCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134115.1-706s1c1
Sequence:CCGGGCTAAACCTCTACCTAATCATCTCGAGATGATTAGGTAGAGGTTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007271
VALIDATED
STK38 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 38
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_007271.2-1231s21c1
Sequence:CCGGGCTCATCGGCTACCCACCTTTCTCGAGAAAGGTGGGTAGCCGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007271.2-875s21c1
Sequence:CCGGGTATTAGCCATAGACTCTATTCTCGAGAATAGAGTCTATGGCTAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007271.2-2026s21c1
Sequence:CCGGTCGTGTATAGTCATCGAATATCTCGAGATATTCGATGACTATACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007271.2-949s21c1
Sequence:CCGGCAGCAAGGGCCATGTGAAACTCTCGAGAGTTTCACATGGCCCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_007271.2-1574s21c1
Sequence:CCGGGAGACTGACTACAAGAACAAACTCGAGTTTGTTCTTGTAGTCAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007271.x-1258s1c1
Sequence:CCGGCAGCAAGGGCCATGTGAAACTCTCGAGAGTTTCACATGGCCCTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007271.x-1883s1c1
Sequence:CCGGGAGACTGACTACAAGAACAAACTCGAGTTTGTTCTTGTAGTCAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007271.x-1540s1c1
Sequence:CCGGGCTCATCGGCTACCCACCTTTCTCGAGAAAGGTGGGTAGCCGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_007271.2-2871s1c1
Sequence:CCGGGCCTGCAACTTAGGCGGATTGCTCGAGCAATCCGCCTAAGTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007271.2-1603s1c1
Sequence:CCGGCTTCATCAATTACACGTACAACTCGAGTTGTACGTGTAATTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007271.2-395s1c1
Sequence:CCGGCAACATGAAGAACGAGAAATGCTCGAGCATTTCTCGTTCTTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007271.2-1806s1c1
Sequence:CCGGCTCCTGAAATGTGGTAGTAAGCTCGAGCTTACTACCACATTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007271.2-875s1c1
Sequence:CCGGGTATTAGCCATAGACTCTATTCTCGAGAATAGAGTCTATGGCTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007271.2-503s1c1
Sequence:CCGGGAAACAGAGTTTCTTCGTTTGCTCGAGCAAACGAAGAAACTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007271.2-381s1c1
Sequence:CCGGGCAACCTTATCGCTCAACATGCTCGAGCATGTTGAGCGATAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007271
VALIDATED
STK38 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 38
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_007271.2-1231s21c1
Sequence:CCGGGCTCATCGGCTACCCACCTTTCTCGAGAAAGGTGGGTAGCCGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007271.2-875s21c1
Sequence:CCGGGTATTAGCCATAGACTCTATTCTCGAGAATAGAGTCTATGGCTAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007271.2-2026s21c1
Sequence:CCGGTCGTGTATAGTCATCGAATATCTCGAGATATTCGATGACTATACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007271.2-949s21c1
Sequence:CCGGCAGCAAGGGCCATGTGAAACTCTCGAGAGTTTCACATGGCCCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_007271.2-1574s21c1
Sequence:CCGGGAGACTGACTACAAGAACAAACTCGAGTTTGTTCTTGTAGTCAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007271.x-1258s1c1
Sequence:CCGGCAGCAAGGGCCATGTGAAACTCTCGAGAGTTTCACATGGCCCTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007271.x-1883s1c1
Sequence:CCGGGAGACTGACTACAAGAACAAACTCGAGTTTGTTCTTGTAGTCAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007271.x-1540s1c1
Sequence:CCGGGCTCATCGGCTACCCACCTTTCTCGAGAAAGGTGGGTAGCCGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_007271.2-2871s1c1
Sequence:CCGGGCCTGCAACTTAGGCGGATTGCTCGAGCAATCCGCCTAAGTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007271.2-1603s1c1
Sequence:CCGGCTTCATCAATTACACGTACAACTCGAGTTGTACGTGTAATTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007271.2-395s1c1
Sequence:CCGGCAACATGAAGAACGAGAAATGCTCGAGCATTTCTCGTTCTTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007271.2-1806s1c1
Sequence:CCGGCTCCTGAAATGTGGTAGTAAGCTCGAGCTTACTACCACATTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007271.2-875s1c1
Sequence:CCGGGTATTAGCCATAGACTCTATTCTCGAGAATAGAGTCTATGGCTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007271.2-503s1c1
Sequence:CCGGGAAACAGAGTTTCTTCGTTTGCTCGAGCAAACGAAGAAACTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007271.2-381s1c1
Sequence:CCGGGCAACCTTATCGCTCAACATGCTCGAGCATGTTGAGCGATAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007271
VALIDATED
STK38 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 38
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_007271.2-1231s21c1
Sequence:CCGGGCTCATCGGCTACCCACCTTTCTCGAGAAAGGTGGGTAGCCGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007271.2-875s21c1
Sequence:CCGGGTATTAGCCATAGACTCTATTCTCGAGAATAGAGTCTATGGCTAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007271.2-2026s21c1
Sequence:CCGGTCGTGTATAGTCATCGAATATCTCGAGATATTCGATGACTATACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007271.2-949s21c1
Sequence:CCGGCAGCAAGGGCCATGTGAAACTCTCGAGAGTTTCACATGGCCCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_007271.2-1574s21c1
Sequence:CCGGGAGACTGACTACAAGAACAAACTCGAGTTTGTTCTTGTAGTCAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007271.x-1258s1c1
Sequence:CCGGCAGCAAGGGCCATGTGAAACTCTCGAGAGTTTCACATGGCCCTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010216    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007271.x-1883s1c1
Sequence:CCGGGAGACTGACTACAAGAACAAACTCGAGTTTGTTCTTGTAGTCAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007271.x-1540s1c1
Sequence:CCGGGCTCATCGGCTACCCACCTTTCTCGAGAAAGGTGGGTAGCCGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_007271.2-2871s1c1
Sequence:CCGGGCCTGCAACTTAGGCGGATTGCTCGAGCAATCCGCCTAAGTTGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007271.2-1603s1c1
Sequence:CCGGCTTCATCAATTACACGTACAACTCGAGTTGTACGTGTAATTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007271.2-395s1c1
Sequence:CCGGCAACATGAAGAACGAGAAATGCTCGAGCATTTCTCGTTCTTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007271.2-1806s1c1
Sequence:CCGGCTCCTGAAATGTGGTAGTAAGCTCGAGCTTACTACCACATTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_007271.2-875s1c1
Sequence:CCGGGTATTAGCCATAGACTCTATTCTCGAGAATAGAGTCTATGGCTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007271.2-503s1c1
Sequence:CCGGGAAACAGAGTTTCTTCGTTTGCTCGAGCAAACGAAGAAACTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007271.2-381s1c1
Sequence:CCGGGCAACCTTATCGCTCAACATGCTCGAGCATGTTGAGCGATAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks