EMAIL THIS PAGE TO A FRIEND

STK38L

serine/threonine kinase 38 like

Synonyms: NDR2
UniProtKB ID: Q9Y2H1, A8K4U0, Q8TBX7
Gene ID:
Mouse(232533) serine/threonine kinase 38 like
Rat(691337) serine/threonine kinase 38 like
Zebrafish(393957) serine/threonine kinase 38 like
domestic cat(101081905) serine/threonine kinase 38 like
dog(477663) serine/threonine kinase 38 like
chicken(418217) serine/threonine kinase 38 like
cow(514787) serine/threonine kinase 38 like
sheep(101111789) serine/threonine kinase 38 like
naked mole-rat(101706716) serine/threonine kinase 38 like
Gene Class: Cytoskeleton
248 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015000 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015000 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015000 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015000 Rosetta Predictions human pricing
NM_001083336 Rosetta Predictions rat pricing
NM_172734 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346769 predicted 1093
2 SASI_Hs01_00074233 predicted 1208
3 SASI_Hs01_00074234 predicted 638
4 SASI_Hs01_00074235 predicted 529
5 SASI_Hs01_00074236 predicted 923
6 SASI_Hs01_00074237 predicted 927
7 SASI_Hs01_00074238 predicted 1194
8 SASI_Hs01_00074239 predicted 1505
9 SASI_Hs01_00074240 predicted 681
10 SASI_Hs01_00074241 predicted 1434
11 SASI_Hs01_00074242 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208859 predicted 1360
2 SASI_Rn02_00208860 predicted 1076
3 SASI_Rn02_00208861 predicted 682
4 SASI_Rn02_00208862 predicted 1329
5 SASI_Rn02_00208863 predicted 753
6 SASI_Rn02_00208864 predicted 544
7 SASI_Rn02_00208865 predicted 894
8 SASI_Rn02_00208866 predicted 666
9 SASI_Rn02_00208867 predicted 1128
10 SASI_Rn02_00208868 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344546 predicted 418
2 SASI_Mm01_00174282 predicted 1258
3 SASI_Mm02_00344547 predicted 680
4 SASI_Mm01_00174288 predicted 1191
5 SASI_Mm01_00174289 predicted 286
6 SASI_Mm02_00344548 predicted 445
7 SASI_Mm02_00344549 predicted 1336
8 SASI_Mm02_00344550 predicted 1240
9 SASI_Mm02_00344551 predicted 266
10 SASI_Mm02_00344552 predicted 430
11 SASI_Mm01_00174280 predicted 906
12 SASI_Mm01_00174281 predicted 977
13 SASI_Mm01_00174283 predicted 534
14 SASI_Mm01_00174284 predicted 788
15 SASI_Mm01_00174285 predicted 692
16 SASI_Mm01_00174286 predicted 521
17 SASI_Mm01_00174287 predicted 584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015000
VALIDATED
STK38L MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 38 like
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015000.1-1061s1c1
Sequence:CCGGGCAGACTGGTTACAACAAATTCTCGAGAATTTGTTGTAACCAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015000.1-1450s1c1
Sequence:CCGGCCACAGAACCGGACTACAAATCTCGAGATTTGTAGTCCGGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015000.1-796s1c1
Sequence:CCGGGTTTCATCCATCGGGATATTACTCGAGTAATATCCCGATGGATGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015000.x-336s1c1
Sequence:CCGGGAAGAAGGATTAGCAGATGAACTCGAGTTCATCTGCTAATCCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015000.x-496s1c1
Sequence:CCGGAGAAGAAAGATACAGGCCATACTCGAGTATGGCCTGTATCTTTCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015000.x-3788s1c1
Sequence:CCGGCCCTGGAGTTAATAGAGTGATCTCGAGATCACTCTATTAACTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015000.x-1099s1c1
Sequence:CCGGTGGGAGTGATTATGTATGAAACTCGAGTTTCATACATAATCACTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015000.x-1356s1c1
Sequence:CCGGCCAGCAGCAATCCCTATAGAACTCGAGTTCTATAGGGATTGCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015000.3-1647s21c1
Sequence:CCGGGGCTTGCTTGGCGTAGATAACCTCGAGGTTATCTACGCCAAGCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015000.3-603s21c1
Sequence:CCGGTCCGAGCAGAAAGAGATATTTCTCGAGAAATATCTCTTTCTGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015000.3-821s21c1
Sequence:CCGGGGTTTCATCCATCGGGATATTCTCGAGAATATCCCGATGGATGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015000.3-1866s21c1
Sequence:CCGGACTGCCTACATGCGTATTAAGCTCGAGCTTAATACGCATGTAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015000.3-1353s21c1
Sequence:CCGGGTGTCGACTGGGAGCACATAACTCGAGTTATGTGCTCCCAGTCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015000.3-894s21c1
Sequence:CCGGTTGGTTTATGTACGGGATTAACTCGAGTTAATCCCGTACATAAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015000
VALIDATED
STK38L MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 38 like
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015000.1-1061s1c1
Sequence:CCGGGCAGACTGGTTACAACAAATTCTCGAGAATTTGTTGTAACCAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015000.1-1450s1c1
Sequence:CCGGCCACAGAACCGGACTACAAATCTCGAGATTTGTAGTCCGGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015000.1-796s1c1
Sequence:CCGGGTTTCATCCATCGGGATATTACTCGAGTAATATCCCGATGGATGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015000.x-336s1c1
Sequence:CCGGGAAGAAGGATTAGCAGATGAACTCGAGTTCATCTGCTAATCCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015000.x-496s1c1
Sequence:CCGGAGAAGAAAGATACAGGCCATACTCGAGTATGGCCTGTATCTTTCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015000.x-3788s1c1
Sequence:CCGGCCCTGGAGTTAATAGAGTGATCTCGAGATCACTCTATTAACTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015000.x-1099s1c1
Sequence:CCGGTGGGAGTGATTATGTATGAAACTCGAGTTTCATACATAATCACTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015000.x-1356s1c1
Sequence:CCGGCCAGCAGCAATCCCTATAGAACTCGAGTTCTATAGGGATTGCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015000.3-1647s21c1
Sequence:CCGGGGCTTGCTTGGCGTAGATAACCTCGAGGTTATCTACGCCAAGCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015000.3-603s21c1
Sequence:CCGGTCCGAGCAGAAAGAGATATTTCTCGAGAAATATCTCTTTCTGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015000.3-821s21c1
Sequence:CCGGGGTTTCATCCATCGGGATATTCTCGAGAATATCCCGATGGATGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015000.3-1866s21c1
Sequence:CCGGACTGCCTACATGCGTATTAAGCTCGAGCTTAATACGCATGTAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015000.3-1353s21c1
Sequence:CCGGGTGTCGACTGGGAGCACATAACTCGAGTTATGTGCTCCCAGTCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015000.3-894s21c1
Sequence:CCGGTTGGTTTATGTACGGGATTAACTCGAGTTAATCCCGTACATAAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015000
VALIDATED
STK38L MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 38 like
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196904    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015000.1-1061s1c1
Sequence:CCGGGCAGACTGGTTACAACAAATTCTCGAGAATTTGTTGTAACCAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015000.1-1450s1c1
Sequence:CCGGCCACAGAACCGGACTACAAATCTCGAGATTTGTAGTCCGGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015000.1-796s1c1
Sequence:CCGGGTTTCATCCATCGGGATATTACTCGAGTAATATCCCGATGGATGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015000.x-336s1c1
Sequence:CCGGGAAGAAGGATTAGCAGATGAACTCGAGTTCATCTGCTAATCCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015000.x-496s1c1
Sequence:CCGGAGAAGAAAGATACAGGCCATACTCGAGTATGGCCTGTATCTTTCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002057    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015000.x-3788s1c1
Sequence:CCGGCCCTGGAGTTAATAGAGTGATCTCGAGATCACTCTATTAACTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015000.x-1099s1c1
Sequence:CCGGTGGGAGTGATTATGTATGAAACTCGAGTTTCATACATAATCACTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015000.x-1356s1c1
Sequence:CCGGCCAGCAGCAATCCCTATAGAACTCGAGTTCTATAGGGATTGCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015000.3-1647s21c1
Sequence:CCGGGGCTTGCTTGGCGTAGATAACCTCGAGGTTATCTACGCCAAGCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015000.3-603s21c1
Sequence:CCGGTCCGAGCAGAAAGAGATATTTCTCGAGAAATATCTCTTTCTGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015000.3-821s21c1
Sequence:CCGGGGTTTCATCCATCGGGATATTCTCGAGAATATCCCGATGGATGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015000.3-1866s21c1
Sequence:CCGGACTGCCTACATGCGTATTAAGCTCGAGCTTAATACGCATGTAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015000.3-1353s21c1
Sequence:CCGGGTGTCGACTGGGAGCACATAACTCGAGTTATGTGCTCCCAGTCGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015000.3-894s21c1
Sequence:CCGGTTGGTTTATGTACGGGATTAACTCGAGTTAATCCCGTACATAAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172734
VALIDATED
STK38L MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 38 like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172734.2-1246s1c1
Sequence:CCGGCCTATAGAAATCCGGAGTATACTCGAGTATACTCCGGATTTCTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172734.2-1189s1c1
Sequence:CCGGCATCCGTTCTTTGAGGGTGTACTCGAGTACACCCTCAAAGAACGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172734.2-390s1c1
Sequence:CCGGGCACATCTATGCCATGAAGATCTCGAGATCTTCATGGCATAGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172734.2-1333s1c1
Sequence:CCGGGAGCCCGACTACAAATCCAAACTCGAGTTTGGATTTGTAGTCGGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172734.2-585s1c1
Sequence:CCGGGCTGATGAAGAAGGACACCTTCTCGAGAAGGTGTCCTTCTTCATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172734.2-274s21c1
Sequence:CCGGACAGAGTTCTTACGCCTTAAGCTCGAGCTTAAGGCGTAAGAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172734.2-250s21c1
Sequence:CCGGCGATCGCAGCATGCTCGTAAACTCGAGTTTACGAGCATGCTGCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172734.2-319s21c1
Sequence:CCGGTTTGAGTCTCTGAAGGTTATACTCGAGTATAACCTTCAGAGACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172734.2-455s21c1
Sequence:CCGGTCCGAGCAGAAAGGGACATTTCTCGAGAAATGTCCCTTTCTGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172734
VALIDATED
STK38L MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 38 like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172734.2-1246s1c1
Sequence:CCGGCCTATAGAAATCCGGAGTATACTCGAGTATACTCCGGATTTCTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172734.2-1189s1c1
Sequence:CCGGCATCCGTTCTTTGAGGGTGTACTCGAGTACACCCTCAAAGAACGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172734.2-390s1c1
Sequence:CCGGGCACATCTATGCCATGAAGATCTCGAGATCTTCATGGCATAGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172734.2-1333s1c1
Sequence:CCGGGAGCCCGACTACAAATCCAAACTCGAGTTTGGATTTGTAGTCGGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172734.2-585s1c1
Sequence:CCGGGCTGATGAAGAAGGACACCTTCTCGAGAAGGTGTCCTTCTTCATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172734.2-274s21c1
Sequence:CCGGACAGAGTTCTTACGCCTTAAGCTCGAGCTTAAGGCGTAAGAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172734.2-250s21c1
Sequence:CCGGCGATCGCAGCATGCTCGTAAACTCGAGTTTACGAGCATGCTGCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172734.2-319s21c1
Sequence:CCGGTTTGAGTCTCTGAAGGTTATACTCGAGTATAACCTTCAGAGACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172734.2-455s21c1
Sequence:CCGGTCCGAGCAGAAAGGGACATTTCTCGAGAAATGTCCCTTTCTGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172734
VALIDATED
STK38L MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 38 like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172734.2-1246s1c1
Sequence:CCGGCCTATAGAAATCCGGAGTATACTCGAGTATACTCCGGATTTCTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172734.2-1189s1c1
Sequence:CCGGCATCCGTTCTTTGAGGGTGTACTCGAGTACACCCTCAAAGAACGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172734.2-390s1c1
Sequence:CCGGGCACATCTATGCCATGAAGATCTCGAGATCTTCATGGCATAGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172734.2-1333s1c1
Sequence:CCGGGAGCCCGACTACAAATCCAAACTCGAGTTTGGATTTGTAGTCGGGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172734.2-585s1c1
Sequence:CCGGGCTGATGAAGAAGGACACCTTCTCGAGAAGGTGTCCTTCTTCATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172734.2-274s21c1
Sequence:CCGGACAGAGTTCTTACGCCTTAAGCTCGAGCTTAAGGCGTAAGAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172734.2-250s21c1
Sequence:CCGGCGATCGCAGCATGCTCGTAAACTCGAGTTTACGAGCATGCTGCGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172734.2-319s21c1
Sequence:CCGGTTTGAGTCTCTGAAGGTTATACTCGAGTATAACCTTCAGAGACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172734.2-455s21c1
Sequence:CCGGTCCGAGCAGAAAGGGACATTTCTCGAGAAATGTCCCTTTCTGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks