EMAIL THIS PAGE TO A FRIEND

STK39

serine threonine kinase 39

Synonyms: DCHT PASK SPAK
UniProtKB ID: Q9UEW8, O14774, Q53S90, Q53SL7, Q53SS1, Q9UER4
Gene ID:
Human(27347) Summary: This gene encodes a serine/threonine kinase that is thought to function in the cellular stress response pathway. The kinase is activated in response to hypotonic stress, leading to phosphorylation of several cation-chloride-coupled cotransporters. The catalytically active kinase specifically activates the p38 MAP kinase pathway, and its interaction with p38 decreases upon cellular stress, suggesting that this kinase may serve as an intermediate in the response to cellular stress. [provided by RefSeq, Jul 2008]
Mouse(53416) serine/threonine kinase 39
Rat(54348) serine threonine kinase 39
domestic guinea pig(100714990) serine threonine kinase 39
naked mole-rat(101712537) serine threonine kinase 39
cow(522103) serine threonine kinase 39
sheep(101108728) serine threonine kinase 39
chicken(424173) serine threonine kinase 39
Horse(100062610) serine threonine kinase 39
domestic cat(101087086) serine threonine kinase 39
dog(478779) serine threonine kinase 39
chicken(101668240) serine threonine kinase 39
chicken(101751124) serine threonine kinase 39
189 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302443 ANTI-MOUSE STK39 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB3500258 Anti-PDCD5 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
SAB4504646 Anti-phospho-STK39 (pSer311) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4301314 Anti-phospho-STK39 (pSer311) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4504645 Anti-phospho-STK39 (pSer325) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB4301313 Anti-phospho-STK39 (pSer325) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB1306411 ANTI-SPAK (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
S5573 Anti-STK39 (388-400) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
PRS4855 Anti-STK39 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV48745 Anti-STK39 (AB1) antibody produced in rabbit affinity isolated antibody human, mouse, guinea pig, rabbit, zebrafish, horse, pig, canine, bovine, rat
western blot pricing
PRS4867 Anti-STK39 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
AV48744 Anti-STK39 (AB2) antibody produced in rabbit IgG fraction of antiserum human, guinea pig, rat, horse, mouse, rabbit, bovine
western blot pricing
SAB2501266 Anti-STK39 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4501217 Anti-STK39 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4501218 Anti-STK39 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
HPA061803 Anti-STK39 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA062802 Anti-STK39 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4100069 Monoclonal Anti-STK39 antibody produced in mouse clone STK39-A50, culture supernatant human
western blot pricing
SAB4100071 Monoclonal Anti-STK39 antibody produced in mouse clone STK39-B50, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013233 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013233 Rosetta Predictions human pricing
NM_019362 Rosetta Predictions rat pricing
NM_016866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243375 predicted 659
2 SASI_Hs02_00344424 predicted 693
3 SASI_Hs01_00243377 predicted 1210
4 SASI_Hs01_00243378 predicted 1485
5 SASI_Hs01_00243379 predicted 935
6 SASI_Hs01_00243380 predicted 792
7 SASI_Hs01_00243381 predicted 1661
8 SASI_Hs01_00243382 predicted 730
9 SASI_Hs01_00243383 predicted 1259
10 SASI_Hs01_00243384 predicted 944
11 SASI_Hs01_00243376 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060105 predicted 1284
2 SASI_Rn02_00262382 predicted 1818
3 SASI_Rn01_00060106 predicted 1073
4 SASI_Rn01_00060107 predicted 1020
5 SASI_Rn01_00060108 predicted 1396
6 SASI_Rn01_00060109 predicted 1478
7 SASI_Rn01_00060111 predicted 1259
8 SASI_Rn01_00060112 predicted 1230
9 SASI_Rn01_00060113 predicted 1756
10 SASI_Rn01_00060114 predicted 977
11 SASI_Rn01_00060110 predicted 824
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172289 predicted 631
2 SASI_Mm01_00172290 predicted 499
3 SASI_Mm02_00323656 predicted 1513
4 SASI_Mm01_00172291 predicted 908
5 SASI_Mm01_00172292 predicted 1007
6 SASI_Mm01_00172293 predicted 969
7 SASI_Mm01_00172295 predicted 951
8 SASI_Mm01_00172296 predicted 1471
9 SASI_Mm01_00172297 predicted 1633
10 SASI_Mm01_00172298 predicted 627
11 SASI_Mm01_00172294 predicted 1016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016866
VALIDATED
STK39 MISSION shRNA Bacterial Glycerol Stock
serine threonine kinase 39
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016866.2-327s21c1
Sequence:CCGGTACGAGCTCCAGGAGGTTATCCTCGAGGATAACCTCCTGGAGCTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016866.2-1962s21c1
Sequence:CCGGCACTCCGAGTTCTGCTTTATTCTCGAGAATAAAGCAGAACTCGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016866.2-1858s21c1
Sequence:CCGGCACTCCCAAATCCCAACAAATCTCGAGATTTGTTGGGATTTGGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016866.2-586s21c1
Sequence:CCGGTCATCAAATACATCGTTAATCCTCGAGGATTAACGATGTATTTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016866.2-396s21c1
Sequence:CCGGCAAGAACGCGTAGCCATAAAGCTCGAGCTTTATGGCTACGCGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016866.2-2686s1c1
Sequence:CCGGGCCGTTCTGTTAGATTGCTAACTCGAGTTAGCAATCTAACAGAACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016866.2-1626s1c1
Sequence:CCGGGTAGTTATAGTGGCTGCTAATCTCGAGATTAGCAGCCACTATAACTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016866.2-1446s1c1
Sequence:CCGGGCCCAACCAAACGCTAATGAACTCGAGTTCATTAGCGTTTGGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016866.2-751s1c1
Sequence:CCGGGCTCAGTACAAATAGCAGATTCTCGAGAATCTGCTATTTGTACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016866.2-968s1c1
Sequence:CCGGCCCTCCAATGAAAGTGCTAATCTCGAGATTAGCACTTTCATTGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016866
VALIDATED
STK39 MISSION shRNA shRNA Plasmid DNA
serine threonine kinase 39
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016866.2-327s21c1
Sequence:CCGGTACGAGCTCCAGGAGGTTATCCTCGAGGATAACCTCCTGGAGCTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016866.2-1962s21c1
Sequence:CCGGCACTCCGAGTTCTGCTTTATTCTCGAGAATAAAGCAGAACTCGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016866.2-1858s21c1
Sequence:CCGGCACTCCCAAATCCCAACAAATCTCGAGATTTGTTGGGATTTGGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016866.2-586s21c1
Sequence:CCGGTCATCAAATACATCGTTAATCCTCGAGGATTAACGATGTATTTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016866.2-396s21c1
Sequence:CCGGCAAGAACGCGTAGCCATAAAGCTCGAGCTTTATGGCTACGCGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016866.2-2686s1c1
Sequence:CCGGGCCGTTCTGTTAGATTGCTAACTCGAGTTAGCAATCTAACAGAACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016866.2-1626s1c1
Sequence:CCGGGTAGTTATAGTGGCTGCTAATCTCGAGATTAGCAGCCACTATAACTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016866.2-1446s1c1
Sequence:CCGGGCCCAACCAAACGCTAATGAACTCGAGTTCATTAGCGTTTGGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016866.2-751s1c1
Sequence:CCGGGCTCAGTACAAATAGCAGATTCTCGAGAATCTGCTATTTGTACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016866.2-968s1c1
Sequence:CCGGCCCTCCAATGAAAGTGCTAATCTCGAGATTAGCACTTTCATTGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016866
VALIDATED
STK39 MISSION shRNA Lentiviral Transduction Particles
serine threonine kinase 39
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016866.2-327s21c1
Sequence:CCGGTACGAGCTCCAGGAGGTTATCCTCGAGGATAACCTCCTGGAGCTCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016866.2-1962s21c1
Sequence:CCGGCACTCCGAGTTCTGCTTTATTCTCGAGAATAAAGCAGAACTCGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016866.2-1858s21c1
Sequence:CCGGCACTCCCAAATCCCAACAAATCTCGAGATTTGTTGGGATTTGGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016866.2-586s21c1
Sequence:CCGGTCATCAAATACATCGTTAATCCTCGAGGATTAACGATGTATTTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016866.2-396s21c1
Sequence:CCGGCAAGAACGCGTAGCCATAAAGCTCGAGCTTTATGGCTACGCGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016866.2-2686s1c1
Sequence:CCGGGCCGTTCTGTTAGATTGCTAACTCGAGTTAGCAATCTAACAGAACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016866.2-1626s1c1
Sequence:CCGGGTAGTTATAGTGGCTGCTAATCTCGAGATTAGCAGCCACTATAACTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016866.2-1446s1c1
Sequence:CCGGGCCCAACCAAACGCTAATGAACTCGAGTTCATTAGCGTTTGGTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016866.2-751s1c1
Sequence:CCGGGCTCAGTACAAATAGCAGATTCTCGAGAATCTGCTATTTGTACTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016866.2-968s1c1
Sequence:CCGGCCCTCCAATGAAAGTGCTAATCTCGAGATTAGCACTTTCATTGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013233
VALIDATED
STK39 MISSION shRNA Bacterial Glycerol Stock
serine threonine kinase 39
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.x-2964s1c1
Sequence:CCGGCCCTGCTTGACTGTATATTATCTCGAGATAATATACAGTCAAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.x-726s1c1
Sequence:CCGGCTACACAGAAACGGTCAGATTCTCGAGAATCTGACCGTTTCTGTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.x-1770s1c1
Sequence:CCGGCCTGATGAAGTGAAGCTGATTCTCGAGAATCAGCTTCACTTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.x-737s1c1
Sequence:CCGGCGGTCAGATTCACAGGGATTTCTCGAGAAATCCCTGTGAATCTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013233.x-674s1c1
Sequence:CCGGAGAGGCAATAATAGCAACAATCTCGAGATTGTTGCTATTATTGCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.1-1094s1c1
Sequence:CCGGGTACGGCAAGTCCTTTAGAAACTCGAGTTTCTAAAGGACTTGCCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013233.1-1572s1c1
Sequence:CCGGCTTAATGACATACGATTTGAGCTCGAGCTCAAATCGTATGTCATTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.1-2921s1c1
Sequence:CCGGCGCTGTTAAGGTTCAAGAATCCTCGAGGATTCTTGAACCTTAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.1-481s1c1
Sequence:CCGGCCAGTATGGATGAACTATTAACTCGAGTTAATAGTTCATCCATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.1-2598s1c1
Sequence:CCGGCCTTGCAAACTTTCACATTAACTCGAGTTAATGTGAAAGTTTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013233.1-534s1c1
Sequence:CCGGCCCAACGTAGTGACCTATTACCTCGAGGTAATAGGTCACTACGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013233
VALIDATED
STK39 MISSION shRNA shRNA Plasmid DNA
serine threonine kinase 39
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.x-2964s1c1
Sequence:CCGGCCCTGCTTGACTGTATATTATCTCGAGATAATATACAGTCAAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.x-726s1c1
Sequence:CCGGCTACACAGAAACGGTCAGATTCTCGAGAATCTGACCGTTTCTGTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.x-1770s1c1
Sequence:CCGGCCTGATGAAGTGAAGCTGATTCTCGAGAATCAGCTTCACTTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.x-737s1c1
Sequence:CCGGCGGTCAGATTCACAGGGATTTCTCGAGAAATCCCTGTGAATCTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013233.x-674s1c1
Sequence:CCGGAGAGGCAATAATAGCAACAATCTCGAGATTGTTGCTATTATTGCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.1-1094s1c1
Sequence:CCGGGTACGGCAAGTCCTTTAGAAACTCGAGTTTCTAAAGGACTTGCCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013233.1-1572s1c1
Sequence:CCGGCTTAATGACATACGATTTGAGCTCGAGCTCAAATCGTATGTCATTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.1-2921s1c1
Sequence:CCGGCGCTGTTAAGGTTCAAGAATCCTCGAGGATTCTTGAACCTTAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.1-481s1c1
Sequence:CCGGCCAGTATGGATGAACTATTAACTCGAGTTAATAGTTCATCCATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.1-2598s1c1
Sequence:CCGGCCTTGCAAACTTTCACATTAACTCGAGTTAATGTGAAAGTTTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013233.1-534s1c1
Sequence:CCGGCCCAACGTAGTGACCTATTACCTCGAGGTAATAGGTCACTACGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013233
VALIDATED
STK39 MISSION shRNA Lentiviral Transduction Particles
serine threonine kinase 39
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.x-2964s1c1
Sequence:CCGGCCCTGCTTGACTGTATATTATCTCGAGATAATATACAGTCAAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.x-726s1c1
Sequence:CCGGCTACACAGAAACGGTCAGATTCTCGAGAATCTGACCGTTTCTGTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.x-1770s1c1
Sequence:CCGGCCTGATGAAGTGAAGCTGATTCTCGAGAATCAGCTTCACTTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.x-737s1c1
Sequence:CCGGCGGTCAGATTCACAGGGATTTCTCGAGAAATCCCTGTGAATCTGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013233.x-674s1c1
Sequence:CCGGAGAGGCAATAATAGCAACAATCTCGAGATTGTTGCTATTATTGCCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.1-1094s1c1
Sequence:CCGGGTACGGCAAGTCCTTTAGAAACTCGAGTTTCTAAAGGACTTGCCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013233.1-1572s1c1
Sequence:CCGGCTTAATGACATACGATTTGAGCTCGAGCTCAAATCGTATGTCATTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.1-2921s1c1
Sequence:CCGGCGCTGTTAAGGTTCAAGAATCCTCGAGGATTCTTGAACCTTAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.1-481s1c1
Sequence:CCGGCCAGTATGGATGAACTATTAACTCGAGTTAATAGTTCATCCATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013233.1-2598s1c1
Sequence:CCGGCCTTGCAAACTTTCACATTAACTCGAGTTAATGTGAAAGTTTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013233.1-534s1c1
Sequence:CCGGCCCAACGTAGTGACCTATTACCTCGAGGTAATAGGTCACTACGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks