EMAIL THIS PAGE TO A FRIEND

STK3

serine/threonine kinase 3

Synonyms: KRS1 MST2
UniProtKB ID: Q13188, A8K722, Q15445, Q15801, Q96FM6
Gene ID:
Human(6788) Summary: This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(56274) serine/threonine kinase 3
Rat(65189) serine/threonine kinase 3
cow(533815) serine/threonine kinase 3
sheep(101106085) serine/threonine kinase 3
domestic guinea pig(100729700) serine/threonine kinase 3
naked mole-rat(101715099) serine/threonine kinase 3
Zebrafish(324125) serine/threonine kinase 3 (STE20 homolog, yeast)
chicken(425375) serine/threonine kinase 3
Horse(100060508) serine/threonine kinase 3
dog(475045) serine/threonine kinase 3
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302396 ANTI-MOUSE STK3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4502885 Anti-MST1 antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
S4448 Anti-STK3 (376-390) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
S4573 Anti-STK3 (416-430) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2502035 Anti-STK3 antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, canine, mouse, human, rat, pig
ELISA, western blot pricing
SAB1406492 Anti-STK3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV48700 Anti-STK3 antibody produced in rabbit affinity isolated antibody zebrafish, human, bovine, rabbit, mouse, guinea pig, rat, horse
western blot pricing
AV48701 Anti-STK3 antibody produced in rabbit IgG fraction of antiserum human, canine, horse, mouse, rabbit, rat, bovine, guinea pig, zebrafish
immunohistochemistry, western blot pricing
HPA007120 Anti-STK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
WH0006788M3 Monoclonal Anti-STK3 antibody produced in mouse clone 1E9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1404423 Monoclonal Anti-STK3 antibody produced in mouse clone 4F7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006281 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019635 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019635 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019635 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006281 siRNAs that have been validated in the lab human pricing
NM_031735 Rosetta Predictions rat pricing
NM_019635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006281 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015485 validated 1617
1 SASI_Hs01_00015487 validated 1260
2 SASI_Hs02_00341258 predicted 835
3 SASI_Hs02_00341259 predicted 272
4 SASI_Hs01_00015488 predicted 809
5 SASI_Hs01_00015489 predicted 1514
6 SASI_Hs01_00015490 predicted 1706
7 SASI_Hs01_00015491 predicted 706
8 SASI_Hs01_00015492 predicted 532
9 SASI_Hs01_00015493 predicted 761
10 SASI_Hs01_00015486 predicted 486
11 SASI_Hs01_00015494 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056484 predicted 440
2 SASI_Rn01_00056485 predicted 1606
3 SASI_Rn01_00056486 predicted 443
4 SASI_Rn01_00056487 predicted 756
5 SASI_Rn01_00056488 predicted 275
6 SASI_Rn01_00056489 predicted 1459
7 SASI_Rn01_00056490 predicted 307
8 SASI_Rn01_00056491 predicted 397
9 SASI_Rn01_00056492 predicted 339
10 SASI_Rn01_00056493 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324666 predicted 1794
2 SASI_Mm01_00030699 predicted 611
3 SASI_Mm02_00324667 predicted 1734
4 SASI_Mm02_00324668 predicted 1665
5 SASI_Mm02_00324669 predicted 837
6 SASI_Mm01_00030701 predicted 698
7 SASI_Mm02_00324670 predicted 1789
8 SASI_Mm01_00030702 predicted 496
9 SASI_Mm02_00324671 predicted 1639
10 SASI_Mm02_00324672 predicted 289
11 SASI_Mm01_00030697 predicted 275
12 SASI_Mm01_00030698 predicted 880
13 SASI_Mm01_00030700 predicted 350
14 SASI_Mm01_00030703 predicted 456
15 SASI_Mm01_00030704 predicted 790
16 SASI_Mm01_00030705 predicted 759
17 SASI_Mm01_00030706 predicted 450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006281
VALIDATED
STK3 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195220    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006281.2-2473s1c1
Sequence:CCGGCAAACTGTAATAAGCTCATCACTCGAGTGATGAGCTTATTACAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006281.2-587s1c1
Sequence:CCGGCTGGAAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006281.x-2718s1c1
Sequence:CCGGGTCATTTCCTAAGCTACATATCTCGAGATATGTAGCTTAGGAAATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006281.x-975s1c1
Sequence:CCGGGAATGCCAAACCTGTATCAATCTCGAGATTGATACAGGTTTGGCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006281.x-1085s1c1
Sequence:CCGGCGGATGAAGATGAGCTGGATTCTCGAGAATCCAGCTCATCTTCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006281.x-839s1c1
Sequence:CCGGCCACAAATCCACCACCAACATCTCGAGATGTTGGTGGTGGATTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006281.x-268s1c1
Sequence:CCGGGCAATACACAAGGAATCCGGTCTCGAGACCGGATTCCTTGTGTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006281.2-1511s21c1
Sequence:GTACCGGCCATGATGGAACGGGAGATAGCTCGAGCTATCTCCCGTTCCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006281.2-1479s21c1
Sequence:GTACCGGAGAACTACAGATGCGGTTAAACTCGAGTTTAACCGCATCTGTAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006281.2-1977s21c1
Sequence:CCGGTCTAGTATACTAGGCTATTTACTCGAGTAAATAGCCTAGTATACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006281.2-882s21c1
Sequence:CCGGGTCCGATGATTTCACCGATTTCTCGAGAAATCGGTGAAATCATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006281.2-1088s21c1
Sequence:CCGGCGGATGAAGATGAGCTGGATTCTCGAGAATCCAGCTCATCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006281.2-812s21c1
Sequence:CCGGTACATCCAATGAGGGCTATTTCTCGAGAAATAGCCCTCATTGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006281.2-287s21c1
Sequence:CCGGCCGGTCAAGTTGTCGCAATTACTCGAGTAATTGCGACAACTTGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006281.2-716s21c1
Sequence:GTACCGGTGATTCAAGAAATAGGCTATACTCGAGTATAGCCTATTTCTTGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006281
VALIDATED
STK3 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195220    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006281.2-2473s1c1
Sequence:CCGGCAAACTGTAATAAGCTCATCACTCGAGTGATGAGCTTATTACAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006281.2-587s1c1
Sequence:CCGGCTGGAAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006281.x-2718s1c1
Sequence:CCGGGTCATTTCCTAAGCTACATATCTCGAGATATGTAGCTTAGGAAATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006281.x-975s1c1
Sequence:CCGGGAATGCCAAACCTGTATCAATCTCGAGATTGATACAGGTTTGGCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006281.x-1085s1c1
Sequence:CCGGCGGATGAAGATGAGCTGGATTCTCGAGAATCCAGCTCATCTTCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006281.x-839s1c1
Sequence:CCGGCCACAAATCCACCACCAACATCTCGAGATGTTGGTGGTGGATTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006281.x-268s1c1
Sequence:CCGGGCAATACACAAGGAATCCGGTCTCGAGACCGGATTCCTTGTGTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006281.2-1511s21c1
Sequence:GTACCGGCCATGATGGAACGGGAGATAGCTCGAGCTATCTCCCGTTCCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006281.2-1479s21c1
Sequence:GTACCGGAGAACTACAGATGCGGTTAAACTCGAGTTTAACCGCATCTGTAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006281.2-1977s21c1
Sequence:CCGGTCTAGTATACTAGGCTATTTACTCGAGTAAATAGCCTAGTATACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006281.2-882s21c1
Sequence:CCGGGTCCGATGATTTCACCGATTTCTCGAGAAATCGGTGAAATCATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006281.2-1088s21c1
Sequence:CCGGCGGATGAAGATGAGCTGGATTCTCGAGAATCCAGCTCATCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006281.2-812s21c1
Sequence:CCGGTACATCCAATGAGGGCTATTTCTCGAGAAATAGCCCTCATTGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006281.2-287s21c1
Sequence:CCGGCCGGTCAAGTTGTCGCAATTACTCGAGTAATTGCGACAACTTGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006281.2-716s21c1
Sequence:GTACCGGTGATTCAAGAAATAGGCTATACTCGAGTATAGCCTATTTCTTGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006281
VALIDATED
STK3 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195220    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006281.2-2473s1c1
Sequence:CCGGCAAACTGTAATAAGCTCATCACTCGAGTGATGAGCTTATTACAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006281.2-587s1c1
Sequence:CCGGCTGGAAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006281.x-2718s1c1
Sequence:CCGGGTCATTTCCTAAGCTACATATCTCGAGATATGTAGCTTAGGAAATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006281.x-975s1c1
Sequence:CCGGGAATGCCAAACCTGTATCAATCTCGAGATTGATACAGGTTTGGCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006281.x-1085s1c1
Sequence:CCGGCGGATGAAGATGAGCTGGATTCTCGAGAATCCAGCTCATCTTCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006281.x-839s1c1
Sequence:CCGGCCACAAATCCACCACCAACATCTCGAGATGTTGGTGGTGGATTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006281.x-268s1c1
Sequence:CCGGGCAATACACAAGGAATCCGGTCTCGAGACCGGATTCCTTGTGTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006281.2-1511s21c1
Sequence:GTACCGGCCATGATGGAACGGGAGATAGCTCGAGCTATCTCCCGTTCCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006281.2-1479s21c1
Sequence:GTACCGGAGAACTACAGATGCGGTTAAACTCGAGTTTAACCGCATCTGTAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006281.2-1977s21c1
Sequence:CCGGTCTAGTATACTAGGCTATTTACTCGAGTAAATAGCCTAGTATACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006281.2-882s21c1
Sequence:CCGGGTCCGATGATTTCACCGATTTCTCGAGAAATCGGTGAAATCATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006281.2-1088s21c1
Sequence:CCGGCGGATGAAGATGAGCTGGATTCTCGAGAATCCAGCTCATCTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006281.2-812s21c1
Sequence:CCGGTACATCCAATGAGGGCTATTTCTCGAGAAATAGCCCTCATTGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006281.2-287s21c1
Sequence:CCGGCCGGTCAAGTTGTCGCAATTACTCGAGTAATTGCGACAACTTGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006281.2-716s21c1
Sequence:GTACCGGTGATTCAAGAAATAGGCTATACTCGAGTATAGCCTATTTCTTGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019635
VALIDATED
STK3 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019635.1-579s1c1
Sequence:CCGGCCGGGAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019635.1-293s1c1
Sequence:CCGGGCAATTAAGCAAGTACCTGTTCTCGAGAACAGGTACTTGCTTAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019635.1-701s1c1
Sequence:CCGGCCTGAGGTAATTCAAGAAATACTCGAGTATTTCTTGAATTACCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019635.1-1519s1c1
Sequence:CCGGCCCATGATGGAACGAGAAATACTCGAGTATTTCTCGTTCCATCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019635.1-1322s1c1
Sequence:CCGGCCTTCTTTCATGGACTACTTTCTCGAGAAAGTAGTCCATGAAAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019635.2-1983s21c1
Sequence:CCGGCTGCAAGAGAACTAATCTAAACTCGAGTTTAGATTAGTTCTCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019635.2-700s21c1
Sequence:CCGGCCGGGAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019635.2-925s21c1
Sequence:CCGGTACATCCGATGAGGGCTATTTCTCGAGAAATAGCCCTCATCGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019635.2-1861s21c1
Sequence:CCGGTGATGGTACACACCTAGATAACTCGAGTTATCTAGGTGTGTACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019635.2-1641s21c1
Sequence:CCGGCCCATGATGGAACGAGAAATACTCGAGTATTTCTCGTTCCATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019635.2-822s21c2
Sequence:CCGGCCTGAGGTAATTCAAGAAATACTCGAGTATTTCTTGAATTACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019635
VALIDATED
STK3 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019635.1-579s1c1
Sequence:CCGGCCGGGAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019635.1-293s1c1
Sequence:CCGGGCAATTAAGCAAGTACCTGTTCTCGAGAACAGGTACTTGCTTAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019635.1-701s1c1
Sequence:CCGGCCTGAGGTAATTCAAGAAATACTCGAGTATTTCTTGAATTACCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019635.1-1519s1c1
Sequence:CCGGCCCATGATGGAACGAGAAATACTCGAGTATTTCTCGTTCCATCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019635.1-1322s1c1
Sequence:CCGGCCTTCTTTCATGGACTACTTTCTCGAGAAAGTAGTCCATGAAAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019635.2-1983s21c1
Sequence:CCGGCTGCAAGAGAACTAATCTAAACTCGAGTTTAGATTAGTTCTCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019635.2-700s21c1
Sequence:CCGGCCGGGAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019635.2-925s21c1
Sequence:CCGGTACATCCGATGAGGGCTATTTCTCGAGAAATAGCCCTCATCGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019635.2-1861s21c1
Sequence:CCGGTGATGGTACACACCTAGATAACTCGAGTTATCTAGGTGTGTACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019635.2-1641s21c1
Sequence:CCGGCCCATGATGGAACGAGAAATACTCGAGTATTTCTCGTTCCATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019635.2-822s21c2
Sequence:CCGGCCTGAGGTAATTCAAGAAATACTCGAGTATTTCTTGAATTACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019635
VALIDATED
STK3 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019635.1-579s1c1
Sequence:CCGGCCGGGAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019635.1-293s1c1
Sequence:CCGGGCAATTAAGCAAGTACCTGTTCTCGAGAACAGGTACTTGCTTAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019635.1-701s1c1
Sequence:CCGGCCTGAGGTAATTCAAGAAATACTCGAGTATTTCTTGAATTACCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019635.1-1519s1c1
Sequence:CCGGCCCATGATGGAACGAGAAATACTCGAGTATTTCTCGTTCCATCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019635.1-1322s1c1
Sequence:CCGGCCTTCTTTCATGGACTACTTTCTCGAGAAAGTAGTCCATGAAAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019635.2-1983s21c1
Sequence:CCGGCTGCAAGAGAACTAATCTAAACTCGAGTTTAGATTAGTTCTCTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019635.2-700s21c1
Sequence:CCGGCCGGGAATATTCTCCTCAATACTCGAGTATTGAGGAGAATATTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019635.2-925s21c1
Sequence:CCGGTACATCCGATGAGGGCTATTTCTCGAGAAATAGCCCTCATCGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019635.2-1861s21c1
Sequence:CCGGTGATGGTACACACCTAGATAACTCGAGTTATCTAGGTGTGTACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019635.2-1641s21c1
Sequence:CCGGCCCATGATGGAACGAGAAATACTCGAGTATTTCTCGTTCCATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019635.2-822s21c2
Sequence:CCGGCCTGAGGTAATTCAAGAAATACTCGAGTATTTCTTGAATTACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks