EMAIL THIS PAGE TO A FRIEND

STK40

serine/threonine kinase 40

Synonyms: SHIK SgK495
Gene ID:
Mouse(74178) serine/threonine kinase 40
Rat(360230) serine/threonine kinase 40
Zebrafish(564859) serine/threonine kinase 40
chicken(395120) serine/threonine kinase 40
dog(482475) serine/threonine kinase 40
domestic cat(101089124) serine/threonine kinase 40
Horse(100054972) serine/threonine kinase 40
domestic guinea pig(100726844) serine/threonine kinase 40
naked mole-rat(101719963) serine/threonine kinase 40
cow(515723) serine/threonine kinase 40
sheep(101117812) serine/threonine kinase 40
135 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032017 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078731 MISSION® esiRNA esiRNA human STK40 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032017 Rosetta Predictions human pricing
NM_183056 Rosetta Predictions rat pricing
NM_028800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072875 predicted 775
2 SASI_Hs01_00072876 predicted 834
3 SASI_Hs01_00072877 predicted 485
4 SASI_Hs01_00072878 predicted 1434
5 SASI_Hs01_00072879 predicted 1445
6 SASI_Hs01_00072880 predicted 1927
7 SASI_Hs01_00072881 predicted 1037
8 SASI_Hs01_00072882 predicted 1930
9 SASI_Hs01_00072883 predicted 1918
10 SASI_Hs01_00072884 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116313 predicted 1458
2 SASI_Rn01_00116315 predicted 1186
3 SASI_Rn01_00116316 predicted 564
4 SASI_Rn01_00116318 predicted 1050
5 SASI_Rn02_00269874 predicted 550
6 SASI_Rn01_00116319 predicted 784
7 SASI_Rn01_00116320 predicted 304
8 SASI_Rn01_00116321 predicted 1019
9 SASI_Rn02_00269875 predicted 1068
10 SASI_Rn01_00116322 predicted 244
11 SASI_Rn01_00116314 predicted 1070
12 SASI_Rn01_00116317 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088461 predicted 1450
2 SASI_Mm01_00088462 predicted 1178
3 SASI_Mm01_00088463 predicted 1650
4 SASI_Mm01_00088464 predicted 1554
5 SASI_Mm01_00088465 predicted 784
6 SASI_Mm01_00088466 predicted 637
7 SASI_Mm01_00088467 predicted 797
8 SASI_Mm02_00334407 predicted 756
9 SASI_Mm01_00088468 predicted 562
10 SASI_Mm01_00088469 predicted 1656
11 SASI_Mm01_00088470 predicted 761
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028800
VALIDATED
STK40 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 40
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028800.3-1484s21c1
Sequence:CCGGCACAACGCTATCTGCGGAAATCTCGAGATTTCCGCAGATAGCGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028800.3-1729s21c1
Sequence:CCGGATTCTAGATAGATAGCTAATCCTCGAGGATTAGCTATCTATCTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028800.3-1304s21c1
Sequence:CCGGAGTGCTCCCAATACGAGTTTGCTCGAGCAAACTCGTATTGGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028800.3-710s21c1
Sequence:CCGGAGCGCGAGACTGTGGTCATTTCTCGAGAAATGACCACAGTCTCGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028800.3-1232s21c1
Sequence:CCGGTGCAAGTGGTTCCGGACATTGCTCGAGCAATGTCCGGAACCACTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028800.2-784s1c1
Sequence:CCGGCCATCGGATAACTATCACCAACTCGAGTTGGTGATAGTTATCCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028800.2-866s1c1
Sequence:CCGGCCCGCCTACATCAGTCCTGATCTCGAGATCAGGACTGATGTAGGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028800.2-1203s1c1
Sequence:CCGGCGGACATTGATGACCAAATGACTCGAGTCATTTGGTCATCAATGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028800.2-1270s1c1
Sequence:CCGGCCAATACGAGTTTGAGAACTACTCGAGTAGTTCTCAAACTCGTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028800.2-1443s1c1
Sequence:CCGGCACAACGCTATCTGCGGAAATCTCGAGATTTCCGCAGATAGCGTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028800
VALIDATED
STK40 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 40
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028800.3-1484s21c1
Sequence:CCGGCACAACGCTATCTGCGGAAATCTCGAGATTTCCGCAGATAGCGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028800.3-1729s21c1
Sequence:CCGGATTCTAGATAGATAGCTAATCCTCGAGGATTAGCTATCTATCTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028800.3-1304s21c1
Sequence:CCGGAGTGCTCCCAATACGAGTTTGCTCGAGCAAACTCGTATTGGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028800.3-710s21c1
Sequence:CCGGAGCGCGAGACTGTGGTCATTTCTCGAGAAATGACCACAGTCTCGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028800.3-1232s21c1
Sequence:CCGGTGCAAGTGGTTCCGGACATTGCTCGAGCAATGTCCGGAACCACTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028800.2-784s1c1
Sequence:CCGGCCATCGGATAACTATCACCAACTCGAGTTGGTGATAGTTATCCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028800.2-866s1c1
Sequence:CCGGCCCGCCTACATCAGTCCTGATCTCGAGATCAGGACTGATGTAGGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028800.2-1203s1c1
Sequence:CCGGCGGACATTGATGACCAAATGACTCGAGTCATTTGGTCATCAATGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028800.2-1270s1c1
Sequence:CCGGCCAATACGAGTTTGAGAACTACTCGAGTAGTTCTCAAACTCGTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028800.2-1443s1c1
Sequence:CCGGCACAACGCTATCTGCGGAAATCTCGAGATTTCCGCAGATAGCGTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028800
VALIDATED
STK40 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 40
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028800.3-1484s21c1
Sequence:CCGGCACAACGCTATCTGCGGAAATCTCGAGATTTCCGCAGATAGCGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028800.3-1729s21c1
Sequence:CCGGATTCTAGATAGATAGCTAATCCTCGAGGATTAGCTATCTATCTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028800.3-1304s21c1
Sequence:CCGGAGTGCTCCCAATACGAGTTTGCTCGAGCAAACTCGTATTGGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028800.3-710s21c1
Sequence:CCGGAGCGCGAGACTGTGGTCATTTCTCGAGAAATGACCACAGTCTCGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028800.3-1232s21c1
Sequence:CCGGTGCAAGTGGTTCCGGACATTGCTCGAGCAATGTCCGGAACCACTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028800.2-784s1c1
Sequence:CCGGCCATCGGATAACTATCACCAACTCGAGTTGGTGATAGTTATCCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028800.2-866s1c1
Sequence:CCGGCCCGCCTACATCAGTCCTGATCTCGAGATCAGGACTGATGTAGGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028800.2-1203s1c1
Sequence:CCGGCGGACATTGATGACCAAATGACTCGAGTCATTTGGTCATCAATGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028800.2-1270s1c1
Sequence:CCGGCCAATACGAGTTTGAGAACTACTCGAGTAGTTCTCAAACTCGTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028800.2-1443s1c1
Sequence:CCGGCACAACGCTATCTGCGGAAATCTCGAGATTTCCGCAGATAGCGTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032017
VALIDATED
STK40 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 40
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032017.x-3733s1c1
Sequence:CCGGCCTATTGTAAAGAAACGGAAACTCGAGTTTCCGTTTCTTTACAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_032017.x-788s1c1
Sequence:CCGGCCGGATGGTTAAGAAGATGAACTCGAGTTCATCTTCTTAACCATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_032017.1-1244s1c1
Sequence:CCGGGCAGGAGCTCTTCCGCAAGATCTCGAGATCTTGCGGAAGAGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_032017.1-2697s1c1
Sequence:CCGGCAGTGCCCTTGCCTCATAATACTCGAGTATTATGAGGCAAGGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032017.1-1025s1c1
Sequence:CCGGCAAGAGGACACATCGGATAACCTCGAGGTTATCCGATGTGTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032017.1-1466s1c1
Sequence:CCGGCCAAATGAGCAATGCGGATAGCTCGAGCTATCCGCATTGCTCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032017.1-493s1c1
Sequence:CCGGCAAAGAGAGCTGGACCATTCACTCGAGTGAATGGTCCAGCTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_032017.1-1935s1c1
Sequence:CCGGCCTAGATAACTAATCTGCTTTCTCGAGAAAGCAGATTAGTTATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032017
VALIDATED
STK40 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 40
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032017.x-3733s1c1
Sequence:CCGGCCTATTGTAAAGAAACGGAAACTCGAGTTTCCGTTTCTTTACAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_032017.x-788s1c1
Sequence:CCGGCCGGATGGTTAAGAAGATGAACTCGAGTTCATCTTCTTAACCATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_032017.1-1244s1c1
Sequence:CCGGGCAGGAGCTCTTCCGCAAGATCTCGAGATCTTGCGGAAGAGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_032017.1-2697s1c1
Sequence:CCGGCAGTGCCCTTGCCTCATAATACTCGAGTATTATGAGGCAAGGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032017.1-1025s1c1
Sequence:CCGGCAAGAGGACACATCGGATAACCTCGAGGTTATCCGATGTGTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032017.1-1466s1c1
Sequence:CCGGCCAAATGAGCAATGCGGATAGCTCGAGCTATCCGCATTGCTCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032017.1-493s1c1
Sequence:CCGGCAAAGAGAGCTGGACCATTCACTCGAGTGAATGGTCCAGCTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_032017.1-1935s1c1
Sequence:CCGGCCTAGATAACTAATCTGCTTTCTCGAGAAAGCAGATTAGTTATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032017
VALIDATED
STK40 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 40
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032017.x-3733s1c1
Sequence:CCGGCCTATTGTAAAGAAACGGAAACTCGAGTTTCCGTTTCTTTACAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_032017.x-788s1c1
Sequence:CCGGCCGGATGGTTAAGAAGATGAACTCGAGTTCATCTTCTTAACCATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_032017.1-1244s1c1
Sequence:CCGGGCAGGAGCTCTTCCGCAAGATCTCGAGATCTTGCGGAAGAGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_032017.1-2697s1c1
Sequence:CCGGCAGTGCCCTTGCCTCATAATACTCGAGTATTATGAGGCAAGGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032017.1-1025s1c1
Sequence:CCGGCAAGAGGACACATCGGATAACCTCGAGGTTATCCGATGTGTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032017.1-1466s1c1
Sequence:CCGGCCAAATGAGCAATGCGGATAGCTCGAGCTATCCGCATTGCTCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032017.1-493s1c1
Sequence:CCGGCAAAGAGAGCTGGACCATTCACTCGAGTGAATGGTCCAGCTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_032017.1-1935s1c1
Sequence:CCGGCCTAGATAACTAATCTGCTTTCTCGAGAAAGCAGATTAGTTATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks